Acute and chronic haloperidol treatments increase parkin mRNA levels in the rat brain

Nakahara, Tsutomu; Gotoh, Leo; Motomura, Kinsi; Kawanami, Noriko; Ohta, Eiko; Hirano, Minoru; Uchimura, Hideyuki

doi:10.1016/s0304-3940(01)01880-8

Cited by 11 publications

(10 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Four weeks of haloperidol induced striatal Park2 [21] and whole brain Drd3 [22, 23] expression in rats, suggesting parkin upregulation specific to the nigrostriatal system. In rat pituitary, 21 days of haloperidol upregulated D2 mRNA expression [24].…”

Section: Resultsmentioning

confidence: 99%

The Neuroprotective Disease-Modifying Potential of Psychotropics in Parkinson's Disease

Lauterbach

Fontenelle

Teixeira

2012

Parkinson's Disease

View full text Add to dashboard Cite

Neuroprotective treatments in Parkinson's disease (PD) have remained elusive. Psychotropics are commonly prescribed in PD without regard to their pathobiological effects. The authors investigated the effects of psychotropics on pathobiological proteins, proteasomal activity, mitochondrial functions, apoptosis, neuroinflammation, trophic factors, stem cells, and neurogenesis. Only findings replicated in at least 2 studies were considered for these actions. Additionally, PD-related gene transcription, animal model, and human neuroprotective clinical trial data were reviewed. Results indicate that, from a PD pathobiology perspective, the safest drugs (i.e., drugs least likely to promote cellular neurodegenerative mechanisms balanced against their likelihood of promoting neuroprotective mechanisms) include pramipexole, valproate, lithium, desipramine, escitalopram, and dextromethorphan. Fluoxetine favorably affects transcription of multiple genes (e.g., MAPT, GBA, CCDC62, HIP1R), although it and desipramine reduced MPTP mouse survival. Haloperidol is best avoided. The most promising neuroprotective investigative priorities will involve disease-modifying trials of the safest agents alone or in combination to capture salutary effects on H3 histone deacetylase, gene transcription, glycogen synthase kinase-3, α-synuclein, reactive oxygen species (ROS), reactive nitrogen species (RNS), apoptosis, inflammation, and trophic factors including GDNF and BDNF.

show abstract

Section: Resultsmentioning

confidence: 99%

The Neuroprotective Disease-Modifying Potential of Psychotropics in Parkinson's Disease

Lauterbach

Fontenelle

Teixeira

2012

Parkinson's Disease

View full text Add to dashboard Cite

show abstract

“…It has been shown that parkin expression is increased following endoplasmic reticulum (ER) stress and mitochondrial stress, and the increased levels of parkin prevents ER stress-induced mitochondrial damage and cell death [42]. Also, the postmortem samples used in the present study were obtained from chronic schizophrenia subjects, and therefore, the effects of antipsychotic medications on stress and parkin levels cannot be excluded [43]. Thus, the increase in parkin levels observed in prefrontal cortex of schizophrenia subjects might represents a cytoprotective function of parkin in these subjects.…”

Section: Discussionmentioning

confidence: 99%

Glucocorticoid Regulates Parkin Expression in Mouse Frontal Cortex: Implications in Schizophrenia

Pandya

Crider

Pillai

2014

View full text Add to dashboard Cite

Stress and glucocorticoid hormones, which are released into the circulation following stressful experiences, have been shown to contribute significantly to the manifestation of various psychiatric illnesses including schizophrenia and depression. Studies in rodents have reported dose and time dependent effects of glucocorticoids on the expression of proteins related to neuroplasticity. However, the mechanism(s) involved in the regulation of proteins by glucocorticoids are not clear. Ubiquitin ligases play important role in degradation, trafficking and stabilization of proteins. The present study investigated the effect of glucocorticoid on ubiquitin-proteasome system in mouse frontal cortex. A significant increase in mRNA and protein levels of parkin, an E3 ubiquitin ligase was found in cultured mouse primary cortical neurons following corticosterone treatment. An increase in parkin levels was also found in mouse frontal cortex in vivo following acute dexamethasone treatment. However, chronic treatment with corticosterone did not change parkin protein levels in mouse frontal cortex. Studies using postmortem brain samples from schizophrenia and control subjects indicated a significant increase in parkin protein levels in frontal cortex of schizophrenia subjects suggesting a response to increased stress conditions in schizophrenia. These findings suggest a possible role of parkin in the pathophysiology of stress-related psychiatric disorders.

show abstract

“…Primer sequences were: 5′‐GATCATGTTTGAGACCTT‐3′ for β‐actin forward and 5′‐ATCTTGATCTTCATGGTG‐3′ for β‐actin reverse; 5′‐TGCTGTGGATATTGTTGTGG‐3′ for α‐synuclein forward and 5′‐AGGTGCGTAGTCTCATGCTC‐3′ for α‐synuclein reverse (Rideout et al . 2001); 5′‐ACACCCAACCTCAGACAAGG‐3′ for parkin forward and 5′‐ATCAGGGAGTTGGGACAGC‐ 3′ for parkin reverse (Nakahara et al . 2001).…”

Section: Northern Blot and Rt‐pcrmentioning

confidence: 99%

Proteasome inhibition and aggregation in Parkinson's disease: a comparative study in untransfected and transfected cells

Biasini

Fioriti

Ceglia

et al. 2003

Journal of Neurochemistry

155

View full text Add to dashboard Cite

Dysfunction of the ubiquitin-proteasome system (UPS) has been implicated in Parkinson's disease (PD) and other neurodegenerative disorders. We have investigated the effect of UPS inhibition on the metabolism of a-synuclein (SYN) and parkin, two proteins genetically and histopathologically associated to PD. Pharmacological inhibition of proteasome induced accumulation of both parkin and SYN in transfected PC12 cells. We found that this effect was caused by increased protein synthesis rather than impairment of protein degradation, suggesting that inhibition of the UPS might lead to non-specific up-regulation of cytomegalovirus (CMV)-driven transcription. To investigate whether endogenous parkin and SYN can be substrate of the UPS, untransfected PC12 cells and primary mesencephalic neurones were exposed to proteasome inhibitors, and parkin and SYN expression was evaluated at both protein and mRNA level. Under these conditions, we found that proteasome inhibitors did not affect the level of endogenous parkin and SYN. However, we confirmed that dopaminergic neurones were selectively vulnerable to the toxicity of proteasome inhibitors. Our results indicate that studies involving the use of proteasome inhibitors, particularly those in which proteins are expressed from a heterologous promoter, are subjected to potential artefacts that need to be considered for the interpretation of the role of UPS in PD pathogenesis.

show abstract

Acute and chronic haloperidol treatments increase parkin mRNA levels in the rat brain

Cited by 11 publications

References 19 publications

The Neuroprotective Disease-Modifying Potential of Psychotropics in Parkinson's Disease

The Neuroprotective Disease-Modifying Potential of Psychotropics in Parkinson's Disease

Glucocorticoid Regulates Parkin Expression in Mouse Frontal Cortex: Implications in Schizophrenia

Proteasome inhibition and aggregation in Parkinson's disease: a comparative study in untransfected and transfected cells

Contact Info

Product

Resources

About