Acyldepsipeptide antibiotics kill mycobacteria by preventing the physiological functions of the ClpP1P2 protease

Abstract

Summary The Clp protease complex in Mycobacterium tuberculosis is unusual in its composition, functional importance, and activation mechanism. While most bacterial species contain a single ClpP protein that is dispensable for normal growth, mycobacteria have two ClpPs, ClpP1 and ClpP2, which are essential for viability and together form the ClpP1P2 tetradecamer. Acyldepsipeptide antibiotics of the ADEP class inhibit the growth of Gram-positive firmicutes by activating ClpP and causing unregulated protein degradation. Here we show that, in contrast, mycobacteria are killed by ADEP through inhibition of ClpP function. Although ADEPs can stimulate purified M. tuberculosis ClpP1P2 to degrade larger peptides and unstructured proteins, this effect is weaker than for ClpP from other bacteria and depends on the presence of an additional activating factor (e.g. the dipeptide benzyloxycarbonyl-leucyl-leucine in vitro) to form the active ClpP1P2 tetradecamer. The cell division protein FtsZ, which is a particularly sensitive target for ADEP-activated ClpP in firmicutes, is not degraded in mycobacteria. Depletion of the ClpP1P2 level in a conditional Mycobacterium bovis BCG mutant enhanced killing by ADEP unlike in other bacteria. In summary, ADEPs kill mycobacteria by preventing interaction of ClpP1P2 with the regulatory ATPases, ClpX or ClpC1, thus inhibiting essential ATP-dependent protein degradation.

Two ways to skin a cat: acyldepsipeptides antibiotics can kill bacteria through activation or inhibition of ClpP activity

“…The asymmetry of the peptidase is important as the ClpP2 ring seems preferred for the binding AAA1 unfoldases or ADEP (Schmitz et al, 2014; Leodolter et al, 2015;Li et al, 2016). For ADEP activation of ClpP1P2 in vitro, ligand mimics such as nonhydrolysable dipeptides are required Schmitz et al, 2014;Famulla et al, 2016;Li et al, 2016) (Fig. 1).…”

“…Because ClpP1P2 is essential, it was important that the authors picked conditions where these lower peptidase levels had minimal basal effects. After identifying these conditions, the authors showed that lowering ClpP1 levels resulted in sensitizing cells to ADEP (Famulla et al, 2016). They showed that this was in sharp contrast to the case in Bacillus, where a similar depletion of ClpP results in protection against ADEPs (Sass et al, 2011;Famulla et al, 2016).…”

“…Levels of FtsZ in M. bovis do not fall during ADEP induced cell death, suggesting that uncontrolled turnover of FtsZ does not underlie the toxic effects of ADEP in this system. Finally, the authors validated that ADEPs inhibit the activity of ClpP1P2 dependent proteases, specifically ClpC1P1P2 (Raju et al ., ; Leodolter et al ., ; Famulla et al ., ).…”

The mycolic acid reductase Rv2509 has distinct structural motifs and is essential for growth in slow‐growing mycobacteria

“…The obtained M. bovis c‐BCG_2529‐4XtetO knock‐in mutant was verified by the diagnostic PCR of genomic DNA using the oligonucleotide pair BCG_2529_L_fw 5′ GTCAGGTAGACGGAGAACAC‐3′ and BCG_2529_L_rev 5′ AGCTCACCGCGCAGAGATTC‐3′ binding outside the allelic exchange substrates used to generate this mutant and subsequent sequencing of PCR products (Supporting information Figure ). For achieving the controlled gene expression of the Mb2537 gene, a synthetic gene ( rev‐tetR ) derived from Tn10 tetR encoding a mutated TetR protein with reversed binding affinity to tetO sites upon the binding of tetracycline (Klotzsche, Ehrt, & Schnappinger, ) was heterologously expressed in the knock‐in mutant by electroporation of the episomal E. coli ‐mycobacterium shuttle plasmid pMV261:: rev‐tetR ‐RBS‐D providing constitutive rev‐tetR gene expression from the HSP60 promoter in mycobacteria using solid medium containing 50 mg/L of hygromycin and 20 mg/L of kanamycin for selection (Famulla et al, ). This yielded the conditional mutant BCG‐Pasteur c‐ BCG2529 ‐4X tetO pMV261:: rev‐tetR ‐RBS‐D (referred to as BCG::P Tet ‐ BCG2529 ) allowing silencing of the BCG2529 gene in the presence of anhydrotetracycline (ATc).…”

“…For achieving the controlled gene expression of the Mb2537 gene, a synthetic gene (rev-tetR) derived from Tn10 tetR encoding a mutated TetR protein with reversed binding affinity to tetO sites upon the binding of tetracycline (Klotzsche, Ehrt, & Schnappinger, 2009) was heterologously expressed in the knock-in mutant by electroporation of the episomal E. coli-mycobacterium shuttle plasmid pMV261::rev-tetR-RBS-D providing constitutive rev-tetR gene expression from the HSP60 promoter in mycobacteria using solid medium containing 50 mg/L of hygromycin and 20 mg/L of kanamycin for selection (Famulla et al, 2016). This yielded the conditional mutant BCG-Pasteur c-BCG2529-4XtetO pMV261::rev-tetR-RBS-D (referred to as BCG::P Tet -BCG2529) allowing silencing of the BCG2529 gene in the presence of anhydrotetracycline (ATc).…”