ADAM17 Mediates MMP9 Expression in Lung Epithelial Cells

Li, Yaqing; Yan, Jianping; Xu, Wenwen; Wang, Hong; Xia, Yingjie; Wang, Huijun; Yunfen, Zhu; Huang, Xiaojun

doi:10.1371/journal.pone.0051701

Cited by 18 publications

(14 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…28 To evoke inflammatory responses in the RTE cells, we used LPS at a concentration of 0.1 mg/mL which was previously shown to induce MMP9 mRNA expression through the NF-kB pathway in A549 lung epithelial cells. 29 A role of MMP-9 in the development of inflammation is also well established as an inflammatory marker. 30,31 To determine whether rCC16 plays an anti-inflammation Figure 2, increased expression of MMP-9 was observed on both mRNA (Figure 2(a)) and protein levels (Figure 2(b)) in LPS-treated RTE cells, and these LPS-stimulated MMP-9 expressions were inhibited by rCC16 in a dose-dependent manner, being significant at concentrations over 1.0 mg/mL.…”

Section: Rcc16 Inhibits Lps-induced Mmp-9 Expression In Rte Cellsmentioning

confidence: 99%

“…The results showed that PDTC significantly inhibited LPS-evoked MMP9 protein expression (supplemental Figure 3), as previously determined under similar conditions in the lung epithelial cells. 29 We next performed dual luciferase reporter assays to assess whether suppression of MMP-9 by rCC16 in LPS-stimulated RTE cells is dependent on NF-kB-mediated transcriptional activation. As shown in Figure 3(a), LPS caused an approximate ninefold increase in relative luciferase activity, and rCC16 inhibited LPS-induced NF-kB transcriptional activity in a concentration-dependent manner, from 38.8% at 1.0 mg/ mL to 62.6% reduction at 2.0 mg/mL.…”

Section: Rcc16 Inhibits Lps-induced Mmp-9 Expression In Rte Cellsmentioning

confidence: 99%

See 1 more Smart Citation

Recombinant rat CC16 protein inhibits LPS-induced MMP-9 expression via NF-κB pathway in rat tracheal epithelial cells

Pang

Wang

Bai

et al. 2015

Exp Biol Med (Maywood)

View full text Add to dashboard Cite

Clara cell protein (CC16) is a well-known anti-inflammatory protein secreted by the epithelial Clara cells of the airways. It is involved in the development of airway inflammatory diseases such as chronic obstructive pulmonary disease and asthma. Previous studies suggest that CC16 gene transfer suppresses expression of interleukin (IL)-8 in bronchial epithelial cells. However, its role in the function of these cells during inflammation is not well understood. In this study, we evaluated the effect of CC16 on the expression of matrix metalloproteinase (MMP)-9 in lipopolysaccharide (LPS)-stimulated rat tracheal epithelial cells and its underlying molecular mechanisms. We generated recombinant rat CC16 protein (rCC16) which was bioactive in inhibiting the activity of phospholipase A2. rCC16 inhibited LPS-induced MMP-9 expression at both mRNA and protein levels in a concentration-dependent (0-2 µg/mL) manner, as demonstrated by real time RT-PCR, ELISA, and zymography assays. Gene transcription and DNA binding studies demonstrated that rCC16 suppressed LPS-induced NF-κB activation and its binding of gene promoters as identified by luciferase reporter and gel mobility shift assays, respectively. Western blotting and immunofluorescence staining analyses further revealed that rCC16 concentration dependently inhibited the effects of LPS on nuclear increase and cytosol reduction of NF-κB, on the phosphorylation and reduction of NF-κB inhibitory IκBα, and on p38 MAPK-dependent NF-κB activation by phosphorylation at Ser276 of its p65 subunit. These data indicate that inhibition of LPS-mediated NF-κB activation by rCC16 involves both translocation- and phosphorylation-dependent signaling pathways. When the tracheal epithelial cells were pretreated with chlorpromazine, an inhibitor of clathrin-mediated endocytosis, cellular uptake of rCC16 and its inhibition of LPS-induced NF-κB nuclear translocation and also MMP-9 production were significantly abolished. Taken together, our data suggest that clathrin-mediated uptake of rCC16 suppresses LPS-mediated inflammatory MMP-9 production through inactivation of NF-κB and p38 MAPK pathways in tracheal epithelial cells.

show abstract

Section: Rcc16 Inhibits Lps-induced Mmp-9 Expression In Rte Cellsmentioning

confidence: 99%

Section: Rcc16 Inhibits Lps-induced Mmp-9 Expression In Rte Cellsmentioning

confidence: 99%

Recombinant rat CC16 protein inhibits LPS-induced MMP-9 expression via NF-κB pathway in rat tracheal epithelial cells

Pang

Wang

Bai

et al. 2015

Exp Biol Med (Maywood)

View full text Add to dashboard Cite

show abstract

“…TNF-α induces the NF-κB signaling pathway to mediate the matrix metalloproteinase-9 (MMP-9) expression (25,26). Findings of a recent study showed that ADAM17 can mediate MMP-9 expression in lung epithelial cells (27). Therefore, we hypothesized that miR-145 is able to inhibit the HCC cell growth by moderating the ADAM17/MMP-9 pathway.…”

Section: Introductionmentioning

confidence: 99%

MicroRNA-145 inhibits cell proliferation by directly targeting ADAM17 in hepatocellular carcinoma

Liu

Wáng

et al. 2014

Oncology Reports

View full text Add to dashboard Cite

MicroRNAs (miRNAs) are key regulators in cell processes. Emerging evidence has suggested that there is a direct association between miRNAs and cancer. However, the exact regulatory mechanisms of miRNAs in tumorigenesis are poorly understood. In the present study, we showed that miR-145 is able to significantly reduce mRNA and protein expression levels of A disintegrin and metalloproteinase 17 (ADAM17) in liver cancer cells (SMMC-7721, BEL-7402 and Huh-7). Dual luciferase reporter assays confirmed that ADAM17 is a direct target of miR-145. Notably, we found that miR-145 inhibits cell proliferation and growth activity in SMMC-7721 cells. These results demonstrated that it may be exert the function of tumor suppression in a particular link of cancer cell growth. Further studies revealed that the silencing of ADAM17 decreased the proliferation and growth activity of SMMC-7721 cells. Moreover, it reduced the expression of MMP-9. In conclusion, miR-145 inhibits liver cancer cell proliferation by directly targeting ADAM17. Thus, it may become a promising biological target in the treatment strategy of hepatocellular carcinoma.

show abstract

“…The human ADAM17 mRNA sequence (GenBank accession number: NM_003183) was used to determine suitable siRNA target sequences and CCTATGTCGATGCTGAACAAA was selected. The recombinant pLVTHM vectors were constructed by Sangon Biotech Co., Ltd. (Shanghai, China) as the previous study . The orientation of the inserted shRNA cassettes was verified by restriction enzyme analysis and DNA sequencing.…”

Section: Methodsmentioning

confidence: 99%

“…The recombinant pLVTHM vectors were constructed by Sangon Biotech Co., Ltd. (Shanghai, China) as the previous study. 18 The orientation of the inserted shRNA cassettes was verified by restriction enzyme analysis and DNA sequencing. A negative control (NC) siRNA sequence (TTCTCCGAACGTGTCACGT) was used as a control for ADAM17 siRNA.The recombinant pLVTHM vectors and packaging helper plasmids were co-transfected into 293T cells (Shanghai Institute of Biology, Chinese Academy of Sciences, China) with calcium phosphate.…”

Section: Lentivirus Production and Transductionmentioning

confidence: 99%

Lentivirus‐mediated disintegrin and metalloproteinase 17 RNA interference reversed the acquired resistance to gefitinib in lung adenocarcinoma cells in vitro

Liu

Ying

et al. 2017

Biotechnology Progress

Self Cite

View full text Add to dashboard Cite

Objective: The aim of the study is to evaluate the effects of silencing a disintegrin and metalloproteinase 17 (ADAM17) gene expression by lentivirus-mediated RNA interference (RNAi) in the gefitinib-resistant lung adenocarcinoma cells, and then to explore whether the recombinant lentivirus mediated ADAM17 RNAi reversed the acquired resistance of lung adenocarcinoma to gefitinib in vitro.Correspondence concerning this article should be addressed to Y.-Q.Li at lidoctor03@126.com. 196V C 2017 American Institute of Chemical EngineersMethods: The gefitinib-resistant RPC-9 cells were established and the mutations of EGFR were detected by gene sequencing. The ADAM17 shRNA expression vectors were constructed and packaged to recombinant lentivirus. The cell proliferation viability was detected by MTT, and cellular apotosis was analyzed by flow cytometry assay. The expression levels of ADAM17, EGFR and the phosphorylated EGFR were respectively detected by reverse transcription polymerase chain reaction and western blot. TGF-a production in the supernatant was detected by enzyme-linked immunosorbent assay.Results: The gefitinib-resistant RPC-9 cells in which mutated EGFR (exon 20) carried 790T > T/M mutation were established. When the concentrations of gefitinib were less than 10lmol/L, there were no significant changes in the apoptosis and cellular proliferation of RPC-9 with the dose-escalation of gefitinib. The cell proliferation viability of RPC-9 was significantly decreased by lentivirus mediated ADAM17 RNAi (P < 0.05). Gefitinib did not inhibit ADAM17 expression in both the gefitinib-sensitive PC-9 and gefitinib-resistant RPC-9 cells (P > 0.05). Gefitinib had no significant effects on TGF alpha production in the supernatants (P > 0.05). Gefitinib did not inhibit EGFR expression in gefitinib-sensitive PC-9 and gefitinib-resistant RPC-9 cells (P > 0.05). The phosphorylation of EGFR in gefitinib-sensitive PC-9 cells was significantly inhibited by gefitinib (P < 0.05), but that in gefitinib-resistant RPC-9 could not be inhibited by gefitinib (P > 0.05). Lentivirus mediated ADAM17 RNAi significantly inhibited the mRNA and protein expression of ADAM17 in gefitinib-resistant RPC-9 cells (P < 0.05), as well as TGF alpha production in the supernatants (P < 0.05). Also, the phosphorylation of EGFR was significantly reduced in gefitinib-resistant RPC-9 cells by lentivirus mediated ADAM17 RNAi (P < 0.05); however, the mRNA and protein expression of EGFR could not be inhibited. Conclusion:Lentivirus mediated ADAM17 RNAi may reverse the acquired resistance of lung adenocarcinoma to gefitinib via inhibiting the upstream of EGFR signal pathway, which may provide a new therapeutic target to solve the acquired resistance to EGFR tyrosine kinase inhibitors in lung adenocarcinoma.

show abstract

ADAM17 Mediates MMP9 Expression in Lung Epithelial Cells

Cited by 18 publications

References 32 publications

Recombinant rat CC16 protein inhibits LPS-induced MMP-9 expression via NF-κB pathway in rat tracheal epithelial cells

Recombinant rat CC16 protein inhibits LPS-induced MMP-9 expression via NF-κB pathway in rat tracheal epithelial cells

MicroRNA-145 inhibits cell proliferation by directly targeting ADAM17 in hepatocellular carcinoma

Lentivirus‐mediated disintegrin and metalloproteinase 17 RNA interference reversed the acquired resistance to gefitinib in lung adenocarcinoma cells in vitro

Contact Info

Product

Resources

About