Adenovirus E1A Targets the DREF Nuclear Factor To Regulate Virus Gene Expression, DNA Replication, and Growth

Abstract

The adenovirus E1A gene is the first gene expressed upon viral infection. E1A remodels the cellular environment to maximize permissivity for viral replication. E1A is also the major transactivator of viral early gene expression and a coregulator of a large number of cellular genes. E1A carries out its functions predominantly by binding to cellular regulatory proteins and altering their activities. The unstructured nature of E1A enables it to bind to a large variety of cellular proteins and form new molecular complexes with novel functions. The C terminus of E1A is the least-characterized region of the protein, with few known binding partners. Here we report the identification of cellular factor DREF (ZBED1) as a novel and direct binding partner of E1A. Our studies identify a dual role for DREF in the viral life cycle. DREF contributes to activation of gene expression from all viral promoters early in infection. Unexpectedly, it also functions as a growth restriction factor for adenovirus as knockdown of DREF enhances virus growth and increases viral genome copy number late in the infection. We also identify DREF as a component of viral replication centers. E1A affects the subcellular distribution of DREF within PML bodies and enhances DREF SUMOylation. Our findings identify DREF as a novel E1A C terminus binding partner and provide evidence supporting a role for DREF in viral replication. IMPORTANCEThis work identifies the putative transcription factor DREF as a new target of the E1A oncoproteins of human adenovirus. DREF was found to primarily localize with PML nuclear bodies in uninfected cells and to relocalize into virus replication centers during infection. DREF was also found to be SUMOylated, and this was enhanced in the presence of E1A. Knockdown of DREF reduced the levels of viral transcripts detected at 20 h, but not at 40 h, postinfection, increased overall virus yield, and enhanced viral DNA replication. DREF was also found to localize to viral promoters during infection together with E1A. These results suggest that DREF contributes to activation of viral gene expression. However, like several other PML-associated proteins, DREF also appears to function as a growth restriction factor for adenovirus infection.T he interaction of the adenovirus early 1A (E1A) proteins with mammalian regulatory factors has been heavily exploited to elucidate the molecular basis by which they control cellular processes (1-5). Studying the interactions of E1A with new cellular targets provides an exciting opportunity to identify and dissect critical mechanisms controlling mammalian transcription, growth, and differentiation, as well as to identify novel viral regulatory mechanisms. The organization of E1A into short peptide motifs (MoRFs) (6) involved in protein interactions has significantly enriched our understanding of eukaryotic protein function. Identification and characterization of novel MoRFs within E1A allow their subsequent detection in other proteins, which suggests novel interactions leading to signifi...

The Dual Nature of Nek9 in Adenovirus Replication

“…Nek9 was found to occupy the E2 early promoter and, to a lesser extent, the E3 promoter, but not E4 nor the major late promoter (MLP). E1A was found on all promoters tested, as previously observed (24). Recruitment of Nek9 to the E2 early promoter correlated with alteration in expression of E2A (Fig.…”

“…Analysis of expression data was carried out using the Pfaffl method (26), and the data were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA levels and compared between siControl-and siNek9-transfected cells. Primers used for E1B, E2, E3, E4, and hexon were previously described (24). Total E1A was detected with primers binding within exon 2: TCCGGTCCTTCTAACACACC and GGCGTTTACAGCTCAAGTCC, as previously described (27).…”

Inflammasomes and its importance in viral infections

“…The NS1 protein of influenza virus prevents caspase-1 activation and the secretion of IL-1b and IL-18 via an unknown mechanism. The IL-1b and IL-18 pathways have been observed to be regulated by the vaccinia virus protein B15R and the molluscum contagiosum poxvirus proteins MC53L and MC54L, which can bind and inhibit IL-1b and IL-18, respectively [132,133]. Thus, the viral alkaline exonuclease of Epstein Barr virus (BGLF5) down-regulates molecules of the immune system such as TLR-2 and CD1 by degrading the mRNAs that encode them [134].…”

Suppression of Type I Interferon Signaling by E1A via RuvBL1/Pontin

“…Our studies of new C terminus binding proteins have identified DREF (15) and Ku70 (18) as novel E1A interaction partners. Here, we report the identification of another novel E1A C terminus binding protein, RuvBL1 (also known as Pontin and TIP49a).…”

“…Lastly, E1A inhibits histone H2B monoubiquitination by interfering with the RNF20 ubiquitin ligase (14). E1A also interacts with DREF, a component of promyelocytic leukemia protein (PML) bodies that appears to play a role in the innate antiviral response; interference with DREF function by E1A enhances virus growth (15). E4 orf3 is also involved in IFN suppression and inhibition of PML body function and in the immune response (16).…”