Africa, the Odd Man Out: Molecular Biogeography of Dalbergioid Legumes (Fabaceae) Suggests Otherwise

Lavin, Matt; Thulin, Mats; Labat, Jean-Noël; Pennington, R. Toby

doi:10.2307/2666689

Cited by 96 publications

(79 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…(AACTAGTCGGATGGAGTAG) are modified from Lavin et al (2000) and an internal primer trnK_ maiR (GACTTGAAAGATAACCCAGAA) was designed for sequencing; ITS: primers MF (5' TCGAGACCCGAACGGACRAT 3') and MR (GTGCTCGGCATGGGTTCCTT), which were designed in this study based on the ITS sequences of Maianthemum racemosum from GenBank (U23982 and U24041). When amplification of the ITS region was unsuccessful, two internal primers ITS2 and ITS3 (White et al, 1990) were used in the following combinations: MF and ITS2, and ITS3…”

Section: Dna Extraction and Sequencingmentioning

confidence: 99%

“…In taxa for which the primer 3' failed to produce any readable sequences, another primer Z1204R was used (Zurawski et al, 1981). The following pairs were employed for the markers:rps16: primers F and R2 (Oxelman et al, 1997; Andersson and Nova,1999); psbA-trnH: primers psbA and trnH (Sang et al, 1997;Hamilton, 1999); rpl16: primers rpl16_F and R (Asmussen, 1999); ndhF: primers 15F and 2110R or 2070R (Olmstead et al, 1994;Oxelman et al, 1999;Bremer et al, 2002); trnK: primers trnK_685F (GTATCGCACTATGTATGATTTGA) and 2R (AACTAGTCGGATGGAGTAG) are modified from Lavin et al (2000) and an internal primer trnK_ maiR (GACTTGAAAGATAACCCAGAA) was designed for sequencing; ITS: primers MF (5' TCGAGACCCGAACGGACRAT 3') and MR (GTGCTCGGCATGGGTTCCTT), which were designed in this study based on the ITS sequences of Maianthemum racemosum from GenBank (U23982 and U24041). When amplification of the ITS region was unsuccessful, two internal primers ITS2 and ITS3 (White et al, 1990) were used in the following combinations: MF and ITS2, and ITS3 and MR to obtain PCR products in two shorter fragments.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Phylogeny and biogeographic diversification of Maianthemum (Ruscaceae: Polygonatae)

Meng

Wen

Nie

et al. 2008

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

Section: Dna Extraction and Sequencingmentioning

confidence: 99%

mentioning

confidence: 99%

Phylogeny and biogeographic diversification of Maianthemum (Ruscaceae: Polygonatae)

Meng

Wen

Nie

et al. 2008

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

“…Although phylogenetic analysis of combined molecular and nonmolecular data has been completed for Pictetia (Beyra Matos and Lavin 1999; Lavin et al 2000) and Poitea (Lavin 1993), additional phylogenetic analysis is presented here in order to uniformly sample for the same data all species of Pictetia and Poitea. In addition, all close relatives of both Pictetia and Poitea have been sampled exhaustively.…”

Section: Taxon Samplingmentioning

confidence: 99%

“…In addition, all close relatives of both Pictetia and Poitea have been sampled exhaustively. For Pictetia, this includes four other genera in the trans-Atlantic Ormocarpum clade (Diphysa, Zygocarpum, Ormocarpopsis, and Ormocarpum;Lavin et al 2000;Thulin and Lavin 2001) as well as appropriate outgroups identified by Lavin et al (2001). For Poitea, this includes 10 other genera in the primarily North American tribe Robinieae (Hebestigma, Lennea, Gliricidia, Hybosema, Robinia, Poissonia, Coursetia, Olneya, Peteria, Genistidium, and Sphinctospermum;Lavin and Sousa 1995) as well as appropriate outgroups identified in a large-scale legume phylogeny derived from matK sequences (M. F. Wojciechowski, unpublished data).…”

Section: Taxon Samplingmentioning

confidence: 99%

See 1 more Smart Citation

Identifying Tertiary Radiations of Fabaceae in the Greater Antilles: Alternatives to Cladistic Vicariance Analysis

Lavin¹,

Wojciechowski

Richman

et al. 2001

International Journal of Plant Sciences

Self Cite

View full text Add to dashboard Cite

The fossil record shows that the legume family was abundant and taxonomically diverse in Early Tertiary tropical deciduous forests of North America. Today, woody members of this family are almost nonexistent in temperate deciduous forests. This former North American legume diversity now lies in the Tropics, including the Greater Antilles. To show the Antillean refugia, we detail a phylogenetic and biogeographic analysis of two legume groups, the Ormocarpum and Robinia clades, which have either a Tertiary fossil record in North America or a sister clade with such a fossil record. A combined analysis of molecular and nonmolecular data is used for the cladistic vicariance approaches, while an exhaustively sampled data set of nrDNA ITS/5.8S sequences is used for the molecular biogeographic analysis. Results from component, three-area-statements, and Brooks parsimony analysis are equivocal in suggesting an influence of Tertiary history on the distribution of the woody genera Pictetia (Ormocarpum clade) and Poitea (Robinia clade), two of the most speciose endemic legume radiations in the Greater Antilles. Alternatively, nucleotide diversity, evolutionary rates, and coalescent analyses of molecular phylogenies all suggest a Tertiary diversification of Pictetia and Poitea. The results are corroborated by a regression analysis that implicates both age of island biota and island area in accurately predicting numbers of endemic legume taxa. These findings, combined with the legume fossil record, suggest that both Pictetia and Poitea stem from Tertiary North American boreotropical groups. J. A. Wolfe's hypothesis that the Greater Antilles harbor boreotropical relicts is supported.

show abstract

Testing generic limits in Cercidoideae (Leguminosae): Insights from plastid and duplicated nuclear gene sequences

Sinou

Cardinal‐McTeague

Bruneau

2020

TAXON

View full text Add to dashboard Cite

Reconstructing the phylogenetic history of species in large taxonomic groups remains a challenge despite ever increasing access to molecular data. In subfamily Cercidoideae (Leguminosae), the large pantropical Bauhinia s.l. (~380 spp.) is never supported as monophyletic, but the generic boundaries and the number of genera that should be recognised remains a challenging taxonomic and phylogenetic question. Here we reconstruct the phylogeny of Bauhinia s.l. and related genera in the subfamily using sequences obtained from five loci (matK, trnL-F, Leafy, and two previously undetected duplicate copies of Legcyc), which we analyse individually and in a concatenated matrix (excluding Leafy). The individual and concatenated analyses generally support two distinct lineages in Bauhinia s.l.: (1) the Bauhinia clade, containing Bauhinia s.str., Brenierea, and Piliostigma; and (2) the Phanera clade, containing Barklya, Cheniella, Gigasiphon, Lasiobema, Lysiphyllum, Phanera s.str., Schnella, and Tylosema. Based on our analyses, we recognise 14 genera in Cercidoideae. We resurrect the genus Tournaya from Gigasiphon, and synonymise the Asian segregate genus Lasiobema back into Phanera s.str. Our analyses reveal a clear gene duplication event in CYCLOIDEA that is shared by all Cercidoideae excluding the sister lineage to the subfamily, Cercis, supporting recent hypotheses for a whole genome duplication in all Cercidoideae except this genus.

show abstract

Africa, the Odd Man Out: Molecular Biogeography of Dalbergioid Legumes (Fabaceae) Suggests Otherwise

Cited by 96 publications

References 52 publications

Phylogeny and biogeographic diversification of Maianthemum (Ruscaceae: Polygonatae)

Phylogeny and biogeographic diversification of Maianthemum (Ruscaceae: Polygonatae)

Identifying Tertiary Radiations of Fabaceae in the Greater Antilles: Alternatives to Cladistic Vicariance Analysis

Testing generic limits in Cercidoideae (Leguminosae): Insights from plastid and duplicated nuclear gene sequences

Contact Info

Product

Resources

About