Age Estimation by Telomeric Length Using Human (Homo sapiens) and Domestic Cat (Felis catus) Epidermis, Bone and Cartilage Samples was Found to be Ineffective

Abstract

Age estimation using telomere length is an alternative tool that could facilitate the casework in forensic investigations. Although blood can be used in the measurement of telomere length in order to estimate chronological age and/or biological age, the use of blood does present certain potential limitations such as the possibility of infection, the influence of medication, chemicals or the level of stress a subject might have been exposed to, all of which can

Age relationships with telomere length, body weight and body length in wild dugong (Dugong dugon)

“…DNA was measured qualitatively and quantitatively by agarose gel electrophoresis and spectrophotometry at A 260 , respectively, with an A 260 of 1 = 50 ng/μl. Subsequently, dugong DNA (50 ng) was used for measurement of telomere length by qPCR ( Buddhachat et al, 2017 ; Cawthon, 2002 ; Kaewkool et al, 2020 ). A reaction consisted of 1X SensiFAST ™ SYBR ® No-ROX Kit (Bioline, England) was used and contained telomere primer concentrations of 270 nM of tel 1 5′ GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT 3′, and 900 nM of tel 2 5′ TCCCGACTATCCCTATCCCTATCCCTATCTATCCCTA 3′ in a total volume of 10 μl.…”

“…For TL, the source of genomic DNA is a factor and telomeres can shorten at different rates depending on tissue type. For example, bone marrow, endothelium, iliac artery, kidney, lymphocyte, muscle cells, thyroid and dental pulp telomeres shorten at rates of 9, 47-147, 102, 14-60, 41, 24, 90 and 72 bp/year, respectively (Bekaert, De Meyer & Van Oostveldt, 2005;Takubo et al, 2010), while in other tissues (epidermis, bone, cartilage) telomeres do not shorten in relation to aging (Kaewkool et al, 2020). Thus, additional studies in dugongs are warranted to determine actual rates of telomere attrition across different tissue types.…”

“…Telomeres are composed of repeating nucleotides at the ends of chromosomes and important for maintaining chromosome integrity and protecting against DNA deterioration or damage (Fathi et al, 2019;Shay & Wright, 2000). They shorten with each cell division throughout the life of an organism (Fathi et al, 2019;Hewakapuge et al, 2008;Vleck, Haussmann & Vleck, 2003), and so measures of telomere length have been used to estimate age in humans (Homo sapiens) (Hewakapuge et al, 2008;Kaewkool et al, 2020;Karlsson et al, 2008) and other mammalian species, including mice (Mus musculus) (Callicott & Womack, 2006;Whittemore et al, 2019), dogs (Canis lupus familiaris) (Adulyanukosol, Amorena & Miyazaki, 1998;Fick et al, 2012;McKevitt et al, 2002), cats (Felis catus) (Mitchell, 1976), goats (Capra hircus) (Whittemore et al, 2019), Asian elephants (Elephas maximus) (Buddhachat et al, 2017;Whittemore et al, 2019), Australian sea lions (Neophoca cinerea) (Izzo et al, 2011), humpback whales (Megaptera novaeangliae) (Olsen et al, 2014) and bottlenose dolphins (Whittemore et al, 2019). Most of these studies used peripheral blood to determine telomere length and found generally negative relationships with age (R 2 < 0.3), with large variation potentially due to extrinsic (nutrition, behavior and environment) or intrinsic (rate of telomere shortening, initial telomere length, metabolic rate and genetics) factors contributing to low or no significant relationships between age and telomere length measurements using qPCR (Buddhachat et al, 2017;Fick et al, 2012;Hewakapuge et al, 2008;Izzo et al, 2011;Kaewkool et al, 2020;Karlsson et al, 2008).…”

Table 4: Description statistics of linear regression models for body weight, body length and rTL in dugongs < or ≥20 years of age.

“…DNA was measured qualitatively and quantitatively by agarose gel electrophoresis and spectrophotometry at A 260 , respectively, with an A 260 of 1 = 50 ng/ml. Subsequently, dugong DNA (50 ng) was used for measurement of telomere length by qPCR (Buddhachat et al, 2017;Cawthon, 2002;Kaewkool et al, 2020). A reaction consisted of 1X SensiFAST TM SYBR Ò No-ROX Kit (Bioline, England) was used and contained telomere primer concentrations of 270 nM of tel 1 5′ GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT 3′, and 900 nM of tel 2 5′ TCCCGACTATCCCTATCCCTATCCCTATCTATCCCTA 3′ in a total volume of 10 ml.…”