Age-related changes in glutamic acid decarboxylase 1 gene expression in the medial prefrontal cortex and ventral hippocampus of fear-potentiated rats subjected to isolation stress

Sirchi, Mahya Moradi; Motaghi, Sahel; Hosseininasab, Narges sadat; Abbasnejad, Mehdi; Esmaili-Mahani, Saeed; Sepehri, Gholamreza

doi:10.1016/j.bbr.2023.114630

Cited by 2 publications

(2 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The molecular procedure and also the material used in this study including total RNA extraction and cDNA synthesis and etc., were similar to our previous work (Sirchi et al 2023). The primer sequences used were as follows: CX36: Forward: GGGAGACGGTGTACGATGAT; Reverse: TCTGCTTGGCAGATTGATGC CX43: Forward: AGGCGTGAGGAAAGTACCAA; Reverse: TGGGCACCTCTCTTTCACTT GAPDH: Forward: CAAGGCTGAGAATGGGAAGC; Reverse: GAAGACGCCAGTAGACTCCA The real time PCR program for the genes consisted of the following steps: 95°C for 600 seconds, followed by 40 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 20 seconds, and melting curve from 65°C to 95°C, each degree for 6 seconds.…”

Section: Molecular Test To Evaluate (Cx) Gene Expressionsupporting

confidence: 92%

“…Freund and Buzsaki in 1996 showed that cortical interneurons, which use GABA as inhibitory neurotransmitter play an important role in the generation and maintenance of synchronous oscillation in theta and other ranges (Freund and Buzsaki 1996). In a recent study by Sirchi et al, 2023, it has been shown that isolating the rats for two hours increased the gene expression of (GAD 67) the main enzyme responsible for GABA synthesis in the (v Hip) and (m PF) (Sirchi et al 2023). Schoenfeld et al, in 2014 showed that bilateral administration of a speci c blocker of (CX36) i.e., me oquine in (v Hip) and (m PC) reduced theta waves anxiety behavior in (EPM) and open eld test and in inhibitory neurons of these two brain regions (Schoenfeld et al 2014).…”

Section: Discussionmentioning

confidence: 98%

See 1 more Smart Citation

The central expression of connexin 36 and 43 in rat animal models of trait and state anxiety

Alizadeh,

Motaghi,

sirchi

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Purpose There are few studies on the role of gap junctions in anxiety. The Gap junctions are intercellular channels and their subunit is connexin (CX). The specific isoforms of connexins for neurons and astrocytes are (CX36) and (CX43). Here, we examined the gene expression of these connexins in animal models of trait and state anxiety. Methods The animal grouping was as follows: 1) control group, 2) trait anxiety group in which the rats were placed in the elevated plus maze (EPM) 3) diazepam+ trait anxiety group 4) state anxiety group, in which the animals were placed in the (EPM) after tolerating 120 minutes of isolation 5) diazepam + state anxiety group. Using a real time PCR technique, we examined the gene expression of (CX36) and (CX43) in the ventral hippocampus (v Hip), basolateral amygdala (BLA), and medial prefrontal cortex (m PC). Results Data showed that the anxiety of animals in the state anxiety group was significantly higher than the trait anxiety group (p < 0.05). In the state anxiety group, gene expression of (CX36) was lower in (m PC) and (BLA) compared to the control and trait anxiety groups (p < 0.01). The expression of (CX43) in (BLA) and (v Hip) was also lower than in the control and trait anxiety groups. Conclusions This study shows (CX36) and (CX43) reduction in the mentioned structures increases anxiety and the role of these connexins in the state anxiety is more prominent than trait anxiety.

show abstract

Section: Molecular Test To Evaluate (Cx) Gene Expressionsupporting

confidence: 92%

Section: Discussionmentioning

confidence: 98%

The central expression of connexin 36 and 43 in rat animal models of trait and state anxiety

Alizadeh,

Motaghi,

sirchi

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Elephantopus scaber L. Polysaccharides Alleviate Heat Stress-Induced Systemic Inflammation in Mice via Modulation of Characteristic Gut Microbiota and Metabolites

Wang,

Sun,

Deng

et al. 2024

Nutrients

View full text Add to dashboard Cite

Elephantopus scaber L. (ESL) is a Chinese herb that is used both as a food and medicine, often being added to soups in summer in south China to relieve heat stress (HS), but its exact mechanism of action is unknown. In this study, heat-stressed mice were gavaged with ESL polysaccharides (ESLP) at 0, 150, 300, and 450 mg/kg/d−1 (n = 5) for seven days. The gut microbiota composition, short-chain fatty acids (SCFAs), seven neurotransmitters in faeces, expression of intestinal epithelial tight junction (TJ) proteins (Claudin-1, Occludin), and serum inflammatory cytokines were measured. The low dose of ESLP (ESLL) improved the adverse physiological conditions; significantly reduced the cytokines (TNF-α, IL-1β, IL-6) and lipopolysaccharide (LPS) levels (p < 0.05); upregulated the expression of Claudin-1; restored the gut microbiota composition including Achromobacter and Oscillospira, which were at similar levels to those in the normal control group; significantly increased beneficial SCFAs like butyric acid and 5-HT levels in the faeces of heat-stressed mice; and significantly decreased the valeric acid and glutamic acid level. The level of inflammatory markers significantly correlated with the above-mentioned indicators (p < 0.05). Thus, ESLL reduced the HS-induced systemic inflammation by optimizing gut microbiota (Achromobacter, Oscillospira) abundance, increasing gut beneficial SCFAs like butyric acid and 5-HT levels, and reducing gut valeric and glutamic acid levels.

show abstract

Age-related changes in glutamic acid decarboxylase 1 gene expression in the medial prefrontal cortex and ventral hippocampus of fear-potentiated rats subjected to isolation stress

Cited by 2 publications

References 43 publications

The central expression of connexin 36 and 43 in rat animal models of trait and state anxiety

The central expression of connexin 36 and 43 in rat animal models of trait and state anxiety

Elephantopus scaber L. Polysaccharides Alleviate Heat Stress-Induced Systemic Inflammation in Mice via Modulation of Characteristic Gut Microbiota and Metabolites

Contact Info

Product

Resources

About