Aleutian mink disease parvovirus infection of mink peritoneal macrophages and human macrophage cell lines

Abstract

Aleutian mink disease parvovirus (ADV) mRNAs are found in macrophages in lymph nodes and peritoneal exudate cells from ADV-infected mink. Therefore, we developed an in vitro infection system for ADV by using primary cultures of mink macrophages or macrophage cell lines. In peritoneal macrophage cultures from adult mink, virulent ADV-Utah I strain showed nuclear expression of viral antigens with fluorescein isothiocyanatelabeled ADV-infected mink serum, but delineation of specific viral proteins could not be confirmed by immunoblot analysis. Amplification of ADV DNA and production of replicative-form DNA were observed in mink macrophages by Southern blot analysis; however, virus could not be serially propagated. The human macrophage cell line U937 exhibited clear nuclear expression of viral antigens after infection with ADV-Utah I but not with tissue culture-adapted ADV-G. In U937 cells, ADV-Utah I produced mRNA, replicative-form DNA, virion DNA, and structural and nonstructural proteins; however, virus could not be serially passaged nor could [3Hjthymidine-labeled virions be observed by density gradient analysis. These findings indicated that ADV-Utah I infection in U937 cells was not fully permissive and that there is another restricted step between gene amplification and/or viral protein expression and production of infectious virions. Treatment with the macrophage activator phorbol 12-myristate 13-acetate after adsorption of virus reduced the frequency of ADV-positive U937 cells but clearly increased that of human macrophage line THP-1 cells. These results suggested that ADV replication may depend on conditions influenced by the differentiation state of macrophages. U937 cells may be useful as an in vitro model system for the analysis of the immune disorder caused by ADV infection of macrophages.

Subcellular localization of Aleutian mink disease parvovirus proteins and DNA during permissive infection of Crandell feline kidney cells

“…Acute ADV infection of type II pneumocytes in mink kits is permissive and leads to a fulminant pneumonia (3,4,9,27). Chronic infection of adult mink, on the other hand, is associated with profound immune disturbances and restricted viral replication in lymphoid tissues (2,4,9,(20)(21)(22).…”

Sequences of cytotoxic T-lymphocyte epitopes in the Epstein-Barr virus (EBV) nuclear antigen-3B gene in a Japanese population with or without EBV-positive lymphoid malignancies

“…Erythrocytes were removed by hypotonic shock in TE (10 mM Tris, 1 mM EDTA, pH 8.0) buffer and leukocytes collected by centrifugation. DNA was extracted from leukocytes, cell lines and lymphoma tissues as previously described (Kanno et al, 1993), quantified by measuring OD 260 and stored at –30°C until use. Recovery of amplifiable DNA was verified by PCR of the β 2 ‐microglobulin gene, yielding a 330 bp band (Browning et al, 1993).…”

“…Primer sequences for EBNA3B mRNA were 5′‐CCGAGGACCCACCAGATTAT‐3′ (B95‐8 coordinates 95411–95430) in BERF2a and 5′‐TGGCCTGACATCTGTGACGC‐3′ (B958 coordinates 95890–95871) in BERF2b, amplifying a 402 bp segment of mRNA intervening 78 bp intron (Baer et al, 1984; Sample et al, 1990). PCR was performed (1 cycle at 94°C for 3 min, 58°C for 2 min and 72°C for 2 min; 34 cycles at 94°C for 1 min, 58°C for 2 min and 72°C for 2 min), and amplified products were electrophoresed in 2% agarose gels and Southern‐blotted as previously described (Kanno et al, 1993). EBNA3B oligonucleotide probe (5′‐TCTTCGATGTTCAGGTTTTGCTCAAGGAAT‐3′, B95‐8 coordinates 95846–95817 in BERF2b) (Baer et al, 1984; Sample et al, 1990) was 3′‐end labeled with fluorescein‐11‐dUTP using the ECL 3′‐oligolabeling system (Amersham, Aylesbury, UK).…”

Antibody-Dependent Enhancement of Hepatitis C Virus Infection

“…Antiviral antibody can mediate virus infection of a monocytic cell line via FcRII (15). This phenomenon of ADE of infection may play a role in the immunopathogenesis of Aleutian mink disease parvovirus infections in adult mink (15,28,29). We analyzed the capacity of the HMAbs (CBH4B and CBH7) to mediate ADE (Fig.…”

“…The facilitation of HCVpp infection observed by Lavillette et al (36) could not be explained, because heat-treated-decomplemented sera from uninfected donors displayed the same levels of enhancement, and facilitation was not observed when the HCVpp were incubated with normal purified human immunoglobulin. Viruses from various families elicit antibodies that enhance infectivity through the binding of virus-antibody complexes to cellular Fc receptors (FcRs) via the Fc portion of the antibodies (15,21,29,38,52,53,55,57). Infection by an antibody-mediated mechanism may also occur with HCV (23,54).…”