Amazonian waters harbour an ancient freshwater Ceratomyxa lineage (Cnidaria: Myxosporea)

Abstract

A new species of Ceratomyxa parasitizing the gall bladder of Cichla monoculus, an endemic cichlid fish from the Amazon basin in Brazil, is described using morphological and molecular data. In the bile, both immature and mature myxospores were found floating freely or inside elongated plasmodia: length 304 (196-402) μm and width 35.7 (18.3-55.1) μm. Mature spores were elongated and only slightly crescent-shaped in frontal view with a prominent sutural line between two valve cells, which had rounded ends. Measurements of formalin-fixed myxospores: length 6.3±0.6 (5.1-7.5) μm, thickness 41.2±2.9 (37.1-47.6) μm, posterior angle 147°. Lateral projections slightly asymmetric, with lengths 19.3±1.4μm and 20.5±1.3μm. Two ovoid, equal size polar capsules, length 2.6±0.3 (2-3.3) μm, width 2.5±0.4 (1.8-3.7) μm, located adjacent to the suture and containing polar filaments with 3-4 turns. The small subunit ribosomal DNA sequence of 1605 nt was no more than 97% similar to any other sequence in GenBank, and together with the host, locality and morphometric data, supports diagnosis of the parasite as a new species, Ceratomyxa brasiliensis n. sp. Maximum parsimony and maximum likelihood analyses showed that C. brasiliensis n. sp. clustered within the marine Ceratomyxa clade, but was in a basally divergent lineage with two other freshwater species from the Amazon basin. Our results are consistent with previous studies that show Ceratomyxa species can cluster according to both geography and host ecotype, and that the few known freshwater species diverged from marine cousins relatively early in evolution of the genus, possibly driven by marine incursions into riverine environments.

Ceratomyxa gracillima n. sp. (Cnidaria: Myxosporea) provides evidence of panmixia and ceratomyxid radiation in the Amazon basin

“…PCR was performed on a PTC-200 Thermocycler (MJ Research Inc., Watertown, Massachusetts, USA) with initial denaturation at 95 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 62 °C for 30 s (or 58 °C and 60 s with second-round primers) and 72 °C for 120 s, followed by a terminal extension at 72 °C for 7 min. Semi-nested second-round PCR generated overlapping fragments using primers 18E and ACT1R (AATTTCACCTCTCGCTGCCA; Hallett and Diamant, 2001) and MXATK2f (ACGCTTGCGAAGYGTGCCTT, Zatti et al 2017) with 18R (Fig. 2).…”

“…by being highly arcuate, with large and elongated polar capsules (Lom and Dyková, 2006). Available molecular data for Myxodavisia bulani (Fiala, Kodadkova, Freeman, Bartošova-Sojkova and Atkinson, 2015), and Palliatus indecorus (Shulman Kovaleva and Dubina, 1979), demonstrate that these taxa cluster in a basal position within the ‘ Ceratomyxa ’ clade of the marine lineage in ssrDNA-based phylogenetic studies (Fiala et al 2015; Adriano and Okamura, 2017; Zatti et al 2017). Molecular data from additional taxa, particularly from type species, are needed to better assess the validity of maintaining these groups as four distinct genera (Fiala et al 2015; Adriano and Okamura, 2017).…”

“…Within the Ceratomyxa , only six species have been described from strictly freshwater environments, and five of these are from the Amazon basin: C. mylei (syn. Meglitschia mylei ) (Azevedo, Ribeiro, Clemente, Casal, Lopes, Al-Quraishy and Matos, 2011), C. microlepsis (Azevedo, Rocha, Casal, Sao Clemente, Matos, Al-Quraishy and Matos, 2013), C. amazonensis (Mathews, Naldoni, Maia and Adriano, 2016), C. vermiformis Adriano and Okamura, 2017 and C. brasiliensis (Zatti, Atkinson, Bartholomew, Maia and Adriano, 2017). One of these Amazonian species, C. vermiformis , has elongated plasmodial stages that exhibit coordinated, undulatory locomotion, provided by plasmodial cytoskeleton elements, in the bile of its host (Adriano and Okamura, 2017).…”

Morphometeric criteria and partial sequence of the 18S rRNA gene of Ceratomyxa sultani n. sp. from the gallbladder of Upeneus margarethae in the Arabian Gulf, with a note on its seasonal prevalence

“…Ceratomyxa Thélohan, 1892, is the second largest genus among the myxozoan groups, comprising 300 known species, which is about 8% of the myxozoan diversity (Fiala et al, 2015, Abdel-Baki et al, 2017, Zatti et al, 2017). Members of the genus Ceratomyxa are mainly coelozoic, inhabiting the gallbladders of their fish hosts, although a few species have been reported from other organs, including the digestive tract, urinary bladder and kidney tubules (Eiras, 2006).…”

“…Members of the genus Ceratomyxa are mainly coelozoic, inhabiting the gallbladders of their fish hosts, although a few species have been reported from other organs, including the digestive tract, urinary bladder and kidney tubules (Eiras, 2006). The majority of ceratomyxan species have been reported from marine fish hosts, with a few species being described from freshwater teleosts (Zatti et al, 2017). The morphometric features of mature spores in fish hosts are commonly used for the identification and differentiation of Ceratomyxa spp., as is common for all the myxosporean genera.…”