An aptamer-based new method for competitive fluorescence detection of exosomes

Abstract

An aptamer-based low-cost sensitive competitive fluorescence detection method was developed to detect exosomes at concentrations as low as 1.0 × 105 particles per μL.

A serological aptamer-assisted proximity ligation assay for COVID-19 diagnosis and seeking neutralizing aptamers

“…[21][22][23][24][25] These advantages enable aptamers to be a promising receptor, with diverse applications for in vitro and in vivo diagnosis. [26][27][28][29][30][31][32][33][34][35][36][37][38][39] In addition to the choice of receptor, it is also important to develop amplication methods to detect COVID-19 with high sensitivity. Toward this goal, the proximity ligation immunoassay (PLA) has been recently developed as a unique signal amplication approach, 40 in which a protein target is detected by translating antibody-protein binding events into ampliable DNA sequences for subsequent real-time polymerase chain reaction quantication.…”

Immunoassay-aptasensor for the determination of tumor-derived exosomes based on the combination of magnetic nanoparticles and hybridization chain reaction

“…Recently, considering the importance of exosomes in the liquid biopsy of cancer, many studies have explored new detection techniques over the past few decades. 16 A series of novel technologies have been developed for the determination of exosomes, including uorescence detection, 17 electrochemical biosensors, 5,14,18,19 immunosensors, 13,20 surface plasmon resonance (SPR), [21][22][23] microuidic devices, 21 electrochemiluminescence, 24 aptasensors, 25 and spectroscopic analysis. 26 However, these established exosome assays usually involve labour-intensive steps and require extended quantitative protocols and expensive laboratory infrastructures.…”

Acoustofluidics‐Assisted Fluorescence‐SERS Bimodal Biosensors

“…The CDI was used to activate the silanol groups on the silica particle surface, promoting the conjugation process to the primary amine groups of streptavidin molecules. [ 47,48 ] The resultant particles were then modified with biotinylated CD63 aptamer, containing a sequence of 32 bases (CACCCCACCTCGCTCCCGTGACACTAATGCTA), [ 49 ] for specific recognition of exosomes. As such, if fluorescent‐labeled exosomes are present in a solution that is mixed with aptamer‐conjugated silica particles, they will be captured by the silica particles.…”