An improved hemagglutination test for study of canine parvovirus

Senda, M.; Hirayama, Norio; Yamamoto, Hisashi; Kurata, K.

doi:10.1016/0378-1135(86)90035-0

Cited by 41 publications

(30 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…For laboratory testing, the fecal samples should be collected as soon as the enteric signs appear (Carmichael et al, 1980;McAdaragh et al, 1982;Macartney et al, 1984). Several diagnostic tests have been used to detect the virus or the virus genome in fecal samples of dogs with gastroenteritis: hemagglutination (HA) followed by hemagglutination-inhibition (HI) test, enzyme immunoassay (EIA), virus isolation in cell culture and polymerase chain reaction (PCR) (Carmichael et al 1980;Senda et al, 1986;Mochizuki et al, 1993;Senda et al, 1995;Pereira et al, 2000;Costa et al, 2005). PCR has been mostly used for genomic typing of circulating parvovirus strains (CPV-2a or CPV2b) as well as to confirm the presence of wild virus (CPV-2a/2b) in fecal samples of puppies that had received CPV-2 (old type) live virus vaccine (Mochizuki et al, 1993;Senda et al, 1995;Pereira et al, 2000;Costa et al, 2005).…”

Section: Introductionmentioning

confidence: 99%

Clinical and epidemiological aspects of canine parvovirus (CPV) enteritis in the State of Rio de Janeiro: 1995 - 2004

Castro¹,

Miranda²,

Labarthe³

et al. 2007

Arq. Bras. Med. Vet. Zootec.

View full text Add to dashboard Cite

This paper relates the clinical and epidemiological aspects of canine parvovirus infection (CPV) in the State of Rio de Janeiro from April 1995 to March 2004. A total of 341 fecal samples were collected from up to 6-months-old puppies with gastroenteritis. The diagnosis of CPV infection was confirmed by hemagglutination/ hemagglutination inhibition tests, enzyme immunoassay, virus isolation in cell culture or polymerase chain reaction. One hundred and fifty-seven samples (46%) were positive for CPV. No correlation among sex, breed or age and the occurrence of CPV infection was observed. The classical signs of parvoviral enteritis (anorexia, lethargy, vomiting and hemorrhagic fluid diarrhea) were observed in 70% of CPV-positive and in 60% of CPV-negative puppies. Although CPV could be detected throughout the studied period, its occurrence was significantly higher from June to September and November to December. These results show that CPV is still circulating in the State of Rio de Janeiro.Keywords: canine parvovirus (CPV), Rio de Janeiro, clinical signs, enteritis RESUMO Este trabalho relata os aspectos clínicos e epidemiológicos da infecção pelo CPV no Estado do Rio de

show abstract

Section: Introductionmentioning

confidence: 99%

Clinical and epidemiological aspects of canine parvovirus (CPV) enteritis in the State of Rio de Janeiro: 1995 - 2004

Castro¹,

Miranda²,

Labarthe³

et al. 2007

Arq. Bras. Med. Vet. Zootec.

View full text Add to dashboard Cite

show abstract

“…Virus isolates from the U.S.A., France, Belgium, Australia and Japan were tested using the MAbs in haemagglutination inhibition (HI) assays as previously described (Parrish et al, 1982;Senda et al, 1986). Titres were read as the inverse of the last antibody dilution completely inhibiting virus haemagglutination.…”

mentioning

confidence: 99%

The Global Spread and Replacement of Canine Parvovirus Strains

Parrish

Have

Foreyt

et al. 1988

Journal of General Virology

Self Cite

173

150

View full text Add to dashboard Cite

“…Fecal samples were collected directly from the rectum and were kept frozen at -20 o C until being processed. All samples were submitted to hemagglutination (HA) technique in accordance to Senda et al (1986), considering as positive titers equal or greater than 80 UHA. Twenty samples resulted as positive in HA were than submitted to PCR with primers 555F 5'CAGGAAGATATCCA-GAAGGA3' and 555R 5'GGTGCTAGTTGATATGTAATAAACA3', resulting in a fragment of 583 bp from VP2 (Buonavoglia et al 2001).…”

Section: Methodsmentioning

confidence: 99%

“…To detect and characterize canine parvovirus in our region, fecal samples from dogs clinically suspected for canine parvovirus were collected and submitted for laboratory diagnosis by means of a hemagglutination test (Greene 2012, Senda et al 1986); the samples that showed positive results were submitted for PCR (Buonavoglia et al 2001), and subsequently, were sequenced for subtype characterization. The results were associated with age, hematological values, survival, and vaccination status.…”

Section: Introductionmentioning

confidence: 99%

Viral type characterization and clinical aspects of canine parvovirus in naturally infected dogs in São Paulo State, Brazil

et al. 2016

View full text Add to dashboard Cite

Since the first isolation of canine parvovirus type 2 (CPV-2) in late 70's new virus types as CPV-2a and CPV-2b have been emerged and becoming prevalent in natural canine population and more recently, a third subtype was identified , CPV-2c. The main purpose of this study was to detect and characterize canine parvovirus currently present in Central--West region of São Paulo state, in Brazil. Fecal samples were collected of vaccinated and non-vaccinated dogs, clinically suspected of having CPV infection brought to the Infectious Diseases Service, Veterinary Hospital of FMVZ-UNESP. All samples (n=30) were screening for canine parvovirus through hemagglutination test and those resulting as positive (n=20) were submitted to PCR and the products were subsequently sequenced for subtype characterization. Results were tested for association with age, hematological values, viral hemagglutination titers in the feces, vaccination status and survival. Leukopenia was found in all animals, death occurred in 30% of unvaccinated dogs and in 42% of vaccinated ones. In a total of 20 positive sequenced samples, 18 were classified as CPV-2b, one as CPV-2c, and one as CPV-2a, being CPV2a and CPV2c detected in unvaccinated puppies. Compared to the reference samples amino acid change at position 426 in those circling virus was identified. The study results demonstrate the predominance of CPV-2b and the presence of CPV-2a and CPV-2c in naturally infected, vaccinated and unvaccinated dogs in in São Paulo region.INDEX TERMS: Canine parvovirus, PCR, viral type, dogs.

show abstract

An improved hemagglutination test for study of canine parvovirus

Cited by 41 publications

References 9 publications

Clinical and epidemiological aspects of canine parvovirus (CPV) enteritis in the State of Rio de Janeiro: 1995 - 2004

Clinical and epidemiological aspects of canine parvovirus (CPV) enteritis in the State of Rio de Janeiro: 1995 - 2004

The Global Spread and Replacement of Canine Parvovirus Strains

Viral type characterization and clinical aspects of canine parvovirus in naturally infected dogs in São Paulo State, Brazil

Contact Info

Product

Resources

About