An integrated analysis of SOCS1 down‐regulation in HBV infection‐related hepatocellular carcinoma

Abstract

Persistent inflammation together with genetic/epigenetic aberrations is strongly associated with chronic Hepatitis B virus (HBV) infection-related hepatocarcinogenesis. Here, we investigated the alterations of the suppressor of cytokine signalling (SOCS) family genes in HBV-related hepatocellular carcinoma (HCC). A total of 116 patients with HCC were enrolled in this study. The methylation statuses of SOCS1-7 and CISH genes were quantitatively measured and clinicopathological significance of SOCS1 methylation was statistically analysed. The gene copy number variation was assayed by aCGH. Luciferase reporter assay and Western blot were used to detect the involvement of SOCS1 in p53 signalling. We found high frequencies of SOCS1 gene hypermethylation in both tumour (56.03%) and adjacent nontumour tissues (54.31%), but tumour tissues exhibited increased methylation intensity (24.01% vs 13.11%, P < 0.0001), particularly in patients with larger tumour size or cirrhosis background (P < 0.0001). In addition, the frequency and intensity of SOCS1 hypermethylation in tumour tissues were both significantly higher than those in nontumour tissues in male gender patients and in patients ≥45 years old (P = 0.0214 and P < 0.0001, P = 0.0232 and P < 0.0001, respectively). SOCS1 gene deletion was found in 8 of 25 aCGH assayed tumour specimens, which was associated with lower SOCS1 mRNA expression (P = 0.0448). Furthermore, ectopic SOCS1 overexpression could activate the p53 signalling pathway in HCC cell lines. Hypermethylation of SOCS2-7 and CISH genes was seldom found in HCC. Our results suggested that the gene loss and epigenetic silencing of SOCS1 were strongly associated with HBV-related HCC.

Liver regeneration accelerates hepatitis B virus‐related tumorigenesis of hepatocellular carcinoma

“…In addition, SOCS1 and SOCS3 have been implicated in HCC (Niwa et al, 2005;Yoshida et al, 2004;Yoshikawa et al, 2001). The gene loss and epigenetic silencing of SOCS1 and SOCS3 frequently occurred in HBVrelated HCC patients (Niwa et al, 2005;Zhang et al, 2014). Moreover, one recent study reported that HBx could downregulate the expression of SOCS1 through enhancing the methylation of SOCS1 gene promoter (Fu et al, 2016).…”

Aberrant methylation of TRIM58 in hepatocellular carcinoma and its potential clinical implication

“…Numerous genes, such as SOCS1 (17), GSTP1 (26), SFRP1 (27), FOXD3 (28), SYK (29), FAM43B (30), which are involved in tumor suppression, cell cycle regulation, apoptosis, and DNA repair have been shown to be suppressed by DNA hypermethylation in HCC. In our study TRIM58 mRNA expression was significantly reduced in HCC tissues comparing with adjacent non-tumor tissues, while the assessment of DNA methylation by MSRE-qPCR demonstrated that TRIM58 methylation was significantly increased in HCC tissues.…”

SOCS3 Methylation Predicts a Poor Prognosis in HBV Infection-Related Hepatocellular Carcinoma

“…In HCC, Niwa et al revealed that SOCS3 was hypermethylated in 33.3% (6/18) of HCC tissues [ 20 ]. However, in our previous report, we did not observe SOCS3 hypermethylation in HBV-related HCC tissues [ 21 ]. These conflicting results may be due to the complicated etiological mechanism of HCC and the different detected loci in the SOCS3 promoter region.…”

“…The methylation primers of SOCS3 were as follows: Primer 1, forward: AGCTCGAGGGACGCGCGCGCGAA, reverse: CTGAGCCCCCTCGGGTC-CCCAAG; Primer 2, forward: GGTGCCCCAGTCGCTCGGCGAAG, reverse: GGAAGGCG-CGAGCGCGTTGAGTGC. The cut-off value was set at 10%, as previously report [ 21 ].…”