An inwardly rectifying K+ channel is required for patterning

Abstract

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Cancer as a disorder of patterning information: computational and biophysical perspectives on the cancer problem

“…Using a combination of fluorescent voltage-reporter dyes to characterize spatial V mem distributions and functional studies using targeted misexpression of well-characterized ion transporters to specifically modify those gradients in vivo, instructive signaling roles of transmembrane voltage gradients have been identified in embryogenesis and regeneration, adding to the list of such roles identified in classical work that utilized functional physiology [248,249]. A number of recent molecular studies using unbiased approaches in human syndromes and non-human model systems have identified a range of ion channels, gap junctions, and ion pumps in developmental and regenerative morphogenesis of the face, brain, heart, appendages, growth of the cerebellum [250][251][252][253][254][255][256][257][258] and many other structures [259][260][261][262][263][264][265][266][267][268][269][270][271]. These physiological states are ideal inputs for the computational analysis delineated in the next section.…”

Two inwardly rectifying potassium channels,Irk1andIrk2, play redundant roles inDrosophilarenal tubule function

“…Tubules were therefore incubated in amino acid-replete solution, which consists of Drosophila saline supplemented with amino acids and supports more fluid secretion in the Ramsay assay than Drosophila saline (19). Amino acid-replete solution consists of the following (in mM) (19) 4.50 L-lysine, and 1.30 L-valine, pH 7.0. Tubules were incubated for 1 h in the amino acid-replete solution.…”

“…The Drosophila genome encodes three inwardly rectifying K ϩ channels, Irk1 (also called Ir, Dir, or DrKir1), Irk2 (also called DrKir2), and Irk3 (also called dKirIII or DrKir3) (7,20,23). Roles for Irk genes have been described in wing development (4) and cardiotropic viral infections (10). In addition, all three Irk genes are expressed in the principal cell of the Malpighian tubule, and pharmacological experiments using sulphonylureas have suggested a role for Irk channels in tubule function (11).…”

Nonlinear conductance and heterogeneity of voltage-gated ion channels allow defining electrical surface domains in cell membranes

“…Electrical signals in the cell are usually supported by ion channels, blockers, and transporters localized over heterogeneous patches of the membrane surface [4,5]. These channels can control cell cycle progression [6] and patterning [7,8] because electric potential gradients act in concert with specific ligand-receptor instructions. As opposed to the action potential of neurons, electrical potentials in non-neural cells show slow changes along the cell cycle that may be related to changes in the nonlinear conductance of ion channels [4,6].…”

“…Indeed, voltage-gated potassium channels participate in cell hyperpolarization and depolarization processes, control the driving force for the entry of calcium ions into the cell triggering different intracellular signals, and regulate electrical signals over localized domains of the cell surface, providing also relevant positional information [4][5][6]9,13]. In this study, we concentrate mostly on the electrical characteristics of the inward rectifying channels because of their generality and significant role in cell biology [6,7,14,15]. …”