An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication

Abstract

Ebolaviruses, highly lethal zoonotic pathogens, possess longer genomes than most other non-segmented negative-strand RNA viruses due in part to long 5′ and 3′ untranslated regions (UTRs) present in the seven viral transcriptional units. To date, specific functions have not been assigned to these UTRs. With reporter assays, we demonstrated that the Zaire ebolavirus (EBOV) 5′-UTRs lack internal ribosomal entry site function. However, the 5′-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5′-UTR derived from the viral polymerase (L) mRNA strongly suppressed translation of GFP compared to a β-actin 5′-UTR. The L 5′-UTR is one of four viral genes to possess upstream AUGs (uAUGs), and ablation of each uAUG enhanced translation of the primary ORF (pORF), most dramatically in the case of the L 5′-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a “weak” Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress. To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10–100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.

Post-exposure treatments for Ebola and Marburg virus infections

“…mRNAs from filoviruses (those encoding VP35, VP30, VP24 and L) contain initiation sequences similar to those found in the host proteins that remain present after cellular stress, thus shifting host translation towards the production of viral mRNAs, a phenomenon that is supported by the lack of stress granule formation in EBOV-infected cells [115][116][117] .…”

Roles of the Rabies Virus Phosphoprotein Isoforms in Pathogenesis

“…Notably, Shabman et al recently showed by functional analysis of the L gene mRNA of Ebola virus, which contains two overlapped open reading frames (ORFs), that cell stress facilitates its translation from the 2nd start codon, resulting in efficient expression of L protein encoded by the 2nd ORF (27). Therefore, cell stress caused by RABV infection might be involved in the enhanced expression of tPs in infected cells.…”

The VP40 Protein of Marburg Virus Exhibits Impaired Budding and Increased Sensitivity to Human Tetherin following Mouse Adaptation

“…Each cDNA was subsequently used in real-time quantitative PCRs (qPCRs) with human tetherin-specific primers (F, CC ACCTGCAACCACACTG; and R, CCTGAAGCTTATGGTTTAATGTA GTG) designed using the Roche Universal Probe Library Assay Design Center. Tetherin signal was normalized to ␤-actin mRNA using primers previously described (31).…”