Analysis of Caecal Microbiota in Rats Fed with Genetically Modified Rice by Real‐Time Quantitative PCR

Abstract

The effect of genetically modified rice (GMR) on bacterial communities in caecal content was analyzed in a 90-d feeding rat model. A total of 12 groups of rats, which included male and female, were fed with the basal diets containing 30%, 50%, 70% GMR (B(1), B(2), B(3)) or 30%, 50%, 70% non-GMR (D(1), D(2), D(3)). The structure of intestinal microflora was estimated by real-time quantitative PCR (RQ-PCR) based on genus-specific 16s rDNA primers. SYBR Green was used for accurate detection and quantification of 6 kinds of major bacteria shared by humans and rats. According to RQ-PCR, the genome copies of Lactobacillus group from the cecum of male rats fed with 70% non-GMR was higher than those fed with 70% GMR and the relative abundance of Lactobacillus group also higher for group D. This result was in contrast with the E. coli subgroup, which was more numerous in proportion of group B, except D(2) and B(2) for male rats. The Clostridium perfringens subgroup was numerically more abundant in group D than group B of the same level, also except D(2) and B(2) for male rats. These results suggested that GMR had a complex effect on caecal microflora that may be related to the health of the host.

Effect of d‐fagomine on excreted enterobacteria and weight gain in rats fed a high‐fat high‐sucrose diet

“…As expected, the amount of fecal bacteria from healthy animals was not affected by diet : neither the diet nor the supplementation induced any variations in total bacteria which could have been associated with a pathological state . Hence, the model is adequate for nutritional interventions under physiological conditions and d ‐fagomine does not induce any deleterious changes.…”

“…Quantitative real‐time polymerase chain reaction (qRT‐PCR) amplification experiments were performed using a LightCycler® 480 II (Roche, Basel, Switzerland), which monitors the fluorescence intensity of a DNA‐binding dye in each temperature cycle of the DNA amplification. The primer sequences used were: 5′‐ACTCCTACGGGAGGCAGCAGT‐3′ and 3′‐ATTACCGCGGCTGCTGGC‐5′ for total bacteria ; 5′‐ATGGCTGTCGTCAGCTCGT‐3′ and 3′‐CCTACTTCTTTTGCAACCCACT‐5′ for Enterobacteriales ; and 5′‐GTTAATACCTTTGCTCATTGA‐3′ and 3′‐ACCAGGGTATCTAATCCTGTT‐5′ for the E. coli subgroup . Amplicon sizes were corroborated using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).…”

Untitled

“…A number of publications that have argued that genetically modified crops may not be equivalent to conventional crops and may pose a health hazard to the consumer have sparked much debate that continues to this day. For example, some researchers have reported a reduced content of Lactobacillus bacteria in the cecum of laboratory rats fed GMO compared to counterparts that did not receive GMO (Xu, 2011;88), or even increased mortality (Séralini, 2013;476) due to unexplained mechanisms. However, having applied the Bonferroni correction for multiple comparisons to the primary data from seven publications containing such statements (including those cited above), Russian researchers (Panchin, 2017;216) came to the conclusion that the obtained intergroup differences are not statistically significant and, therefore, the data presented in those articles does not provide any considerable evidence of harm to living organisms from genetically modified crops.…”

A comparison of two real-time polymerase chain reaction assays using hybridization probes targeting either 16S ribosomal RNA or a subsurface lipoprotein gene for detecting leptospires in canine urine

“…13 or those causing urinary tract infections (e.g., Enterococcus spp.) 15,25 could be responsible for spurious amplifications by an rrs qPCR assay, 13 a subset of urine samples was tested using a qPCR with a double-stranded DNA-binding dye l and genus-specific primers for the presence of Lactobacillus spp., 38 Enterococcus spp., 18 and Atopobium spp. 8,13 The subset of samples was composed of the 5 samples that originally gave amplification signals in the rrs qPCR assay as well as 40 samples chosen at random after stratification according to the method of collection.…”