Analysis of cDNA clones encoding the entire B-26 region of human apolipoprotein B.

Abstract

We report the characterization of intestine and liver cDNA clones for human apolipoprotein B (apoB) that map to the 5' end of the mRNA. The protein sequence encoded by the 5011 nucleotides derived from sequence analysis of these clones includes 1643 amino acid residues of the mature protein ofMr 184,000. The amino acid sequence at the amino terminus of B-74 peptide was determined and mapped to residue 1298. The size (Mr 145,700) and amino acid composition of the B-26 region encoded by these clones (including amino acid residues 1-1297) closely match the values obtained from the B-26 peptide.The amino acid sequence of psptide B-100 at the junction of peptides B-26 and B-74 (Phe-Lys-Ser) shows structural homology to the site on human kininogen (Phe-Arg-Ser) (4).Two immunochemically related forms ofhuman apoB, B-100 (Mr 550,000) and B-48 (Mr 280,000), have been described (5), each with its own principal metabolic pathway. The B-48 form of apoB is secreted from the intestinal epithelium into the mesenteric lymph in chylomicrons (2). The B-100 form ofapoB is secreted from the liver associated initially with VLDL, and then, after processing of the particle in the blood, with LDL.' Although the exact relationship between B-100 and B-48 is not known, various immunological and structural studies indicate that the two forms have some homology (2).Two additional plasma forms of apoB, B-74 (Mr 407,000) and B-26 (Mr 144,000), have also been described (5). Amino acid composition data suggest that peptides B-74 and B-26 are fragments of B-100. Fragments of similar molecular weight to those of B-74 and B-26 can be obtained in vivo by treating LDL with the proteolytic enzyme plasma kallikrein (6, 7). Recent studies (8) have mapped the B-26 fragment to the amino terminus of B-100. The precise mechanism by which these two apoB peptides are formed in the blood and their physiological significance is not known. Progress in elucidating the structure of apoB is being made through the characterization of cDNA clones. Several groups (8-15) have presented human or rat liver cDNA clones representing a part of the apoB mRNA. Knott et al. (9) have described human liver cDNA clones that code for the 1455 carboxyl-terminal amino acids. We have presented the sequence of a human liver cDNA clone that includes part of the 5' nontranslated region, the signal peptide, and 350 amino acids from the amino terminus (8). In this report we extend the characterization of B-100 protein encoded by cDNA clones of both the liver and the intestine. The 5010 base pairs analyzed code for the amino-terminal 1643 amino acids of B-100.MATERIALS AND METHODS Materials. The 21-base oligonucleotide probe B 1147, CAGCCGCTTCTllTGGTGAAGG, the 22-base oligonucleotide probe B 1254, TCCTCCAGAAGTCTAAAGATGT, and other 17-base oligonucleotides that were used for sequence analysis were prepared as described (8). Radioisotopes were from Amersham, and all restriction enzymes were from New England Biolabs.Purification and Sequence Analysis of B-74 and Fragments of B-26...

Mapping of human apolipoprotein B antigenic determinants.

“…In summary, the five epitopes that have been mapped to T4 on the Nterminal end of apo B are expressed on soluble apo B and do not require apo B association with lipids. This may indicate that apo B conformation in this region of the molecule, which is common to B-100 and B-48, is more affected by intrachain bonding, probably including disulfide bridges, consistent with the locally high number of cysteines in T4, 21 than by protein-lipid interaction.…”

“…The synthesis of peptides reproducing selected partial sequences of apo B on the T4 fragments 21 has allowed the production of specific antisera to these peptides; these antisera have been used in the further mapping of the epitopes present on T4. Monoclonal antibodies 9, 13, and 17 have been shown to compete with one another and with 1D1 in competitive binding experiments.…”

Isolation and characterization of four heparin-binding cyanogen bromide peptides of human plasma apolipoprotein B

“…Protter et al (1986) suggested that residues 14-24 (Lys-Asp-Ala-Thr-Arg-Phe-Lys-His-Leu-Arg-Lys) of the amino-terminal end of apoB-100 might be a heparin-binding region. Although we did not isolate this peptide, we have found (unpublished results) that fragment T4 (in addition to T2 and T3) binds 125I-HRH on ligand blots, indicating one or more heparin-binding domains in the amino-terminal B-26 fragment of apoB-100 (Cardin et al, 1984c(Cardin et al, , 1986bProtter et al, 1986;Hardman et al, 1986).…”

Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100.

“…1 illustrates the positions at which differences in the apoB-100 sequence have been reported. This information was assembled from known DNA polymorphisms (10,11) together with four complete cDNA sequences (12-15), a gene sequence (10), and several partial sequences (16,17). All reported variations are included, even though some may have resulted from cloning or sequencing errors.…”