Analysis of Chromatin Structure in the Control Regions of the Chlamydomonas HSP70A and RBCS2 Genes

Abstract

We have used DNaseI and micrococcal nuclease sensitivity assays to determine the chromatin structures in the control regions of the Chlamydomonas reinhardtii HSP70A and RBCS2 genes. Both genes appear to be organized into nucleosome arrays, which exhibit shorter nucleosome repeat lengths than bulk chromatin. In HSP70A we have identified up to four confined DNaseI hypersensitive sites, three of them localize to the promoter region, a fourth one to the fourth intron. Three hypersensitive sites map close to putative heat shock elements, one close to a CCAAT-box. All hypersensitive sites are located to internucleosomal linkers. Alternative nucleosome positions at half-nucleosomal phasing were constitutively detected in the HSP70A promoter region, indicating local chromatin remodelling. Upon heat shock, dramatic changes in the nucleosome structure of HSP70A were detected that particularly affected the promoter, but also a region within the fourth intron. In contrast, light induction entailed no change in HSP70A chromatin. In the RBCS2 control region we identified a strong DNaseI hypersensitive site that maps close to a CCAAT-box. This site forms the boundary of a nucleosome array with a region of approximately 700 bp apparently devoid of nucleosomes. This study demonstrates that chromatin structure may be determined readily at fairly high resolution in Chlamydomonas, suggesting this organism as a well-suited model for studying the role of chromatin structure on gene expression in photosynthetic eukaryotes.

A New Assay for Promoter Analysis in Chlamydomonas Reveals Roles for Heat Shock Elements and the TATA Box in HSP70A Promoter-Mediated Activation of Transgene Expression

“…As proposed previously (14), these factors might constitutively occupy the promoter and by recruiting chromatin-remodeling activities keep surrounding chromatin in an open state. The mapping of two strong, constitutive nuclease-hypersensitive sites to HSE4 and to the region between the TATA box and HSE1 to HSE3 supports this idea (8).…”

“…The transcriptional start site indicated (ϩ1) is that of promoter part P A1 situated 89 bp upstream from the translational start codon (15). Sequence motifs highlighted within the A promoter are a CCAAT box (C), three inverted CCAAT boxes (C i ), four HSEs (I to IV, large black boxes (8), and the TATA box (T, small black box). Gray boxes designate mutated HSEs/TATA, which destroy the canonical nGAAn/nTTCn and TATAA motifs as follows: HSE1, GCGTCCAGAA GGCGCCATACGG3GacgagctctGGCGCCATACGG; HSE2, GGGGAAGCTCTGGAAGGGCCGCGATGG3GGGGtAtCagatctcGGGCtGCtA TGG; HSE3, ATGAAGCTACAGGACTG3ATtctGCgACgtcACTG; HSE4, GCGAAGGGCCGCGACGGTTCGAGAACCGACTTGAGGG3GCatt GGGCCGCtcCGGagatctAgCCGACTTtAGGG; and TATA, GGTATAAAAG3GGgAcgtcAG (underlining indicates the position of the motif within a sequence, boldfaced nucleotides match the canonical motif, wild-type sequences are in uppercase, and introduced mutations are in lowercase).…”

“…Quantified ble signals were corrected for loading by the CBLP signal. DNA gel blots were hybridized with the ble probe, stripped, and rehybridized with a 263-bp probe derived from sequences upstream from the RBCS2 regulatory sequences (8). Quantified ble signals were corrected for loading by the RBCS2 signal.…”

A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling

“…One of the only mammalian examples is the active mouse kappa Ig gene locus, which has a calculated repeat length of 155 bp in B cells compared to 175 bp for an inactive globin gene (36). Other nonmammalian examples are the Chlamydomonas HSP70A and RBCS2 loci, with repeat lengths of 160 and 156 bp compared to 178 bp in bulk chromatin (26), and an inducible yeast GAL1 promoter construct which undergoes a repeat length decrease from 180 to 160 bp upon activation (6). The simplest explanation for the observed compaction of nucleosomes in the active GM-CSF locus is the exclusion of nucleosomes from the enhancer, accompanied by the loss of histone H1 from the adjacent sequences.…”

Open Chromatin in Plant Genomes

“…The local presence of DHSs within a few plant genes was identified using DNase I cleavage coupled with Southern blot hybridization, including the Adh gene in maize and Arabidopsis [Wu et al, 1979;Vega-Palas and Ferl, 1995], ribosomal RNA genes (rRNA) in barley [Dimitrova et al, 2009] and wheat [Thompson and Flavell, 1988], rbcS in pea [Gorz et al, 1988], heat-shock and abscisic acid inducible genes in wheat [Loer and Spiker, 1992], Proteinase inhibitor I in tomato [Conconi and Ryan, 1993], and HSP 70A and RBCS2 in Chlamydomonas [Lodha and Schroda, 2005]. Remarkably, this Southern blot-based method was used to identify all DHSs within an 80-kb genomic region in Arabidopsis [Kodama et al, 2007a, b].…”