Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction.

Gilliland, Gary; Perrin, Sean; Blanchard, Kerry; Bunn, H. Franklin

doi:10.1073/pnas.87.7.2725

Cited by 1,334 publications

(648 citation statements)

References 13 publications

Supporting

Mentioning

640

Contrasting

Unclassified

Order By: Relevance

“…31 Competitive PCR has been used for quantitative PCR for the past 10 years. [32][33][34] Aliquots of the PCR mixture containing cDNA copies to be assayed are added to serial dilutions of competitor DNA fragments that differ from the cDNA of interest. Therefore, the same primers are used to coamplify the unknown and the competitor.…”

Section: Discussionmentioning

confidence: 99%

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

Tanaka

Kobayashi

Utsuki

et al. 2002

Intl Journal of Cancer

View full text Add to dashboard Cite

Key words: MGMT; real-time RT-PCR; ACNU; gliomaNitrosoureas are alkylating agents that cause cell death by binding to DNA. Among nitrosoureas, 1-(4-amino-2-methyl-5-pyrimidynyl)methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) is widely used in Japan to treat gliomas because of its ability to permeate the blood-brain-barrier and excellent clinical effects in combination with radiation and interferon (IFN)-␤. [1][2][3] Drug-resistance genes are some of the most important elements of tumors themselves in determining drug-resistance, 4 and O 6 -methylguanine-DNA methyltransferase (MGMT) is a drug-resistance gene for nitrosoureas. 5,6 The cross-linking of doublestranded DNA by alkylating agents is inhibited by the cellular DNA-repair protein MGMT. MGMT rapidly reverses alkylation at the O 6 position of guanine, thereby averting lethal cross-linking. 7 This is the mechanism by which MGMT induces resistance to alkylating agents such as ACNU.Protocol studies for malignant gliomas have not provided encouraging therapeutic results because of the heterogeneity and various drug-sensitivities of the tumors. 8,9 Individualization of glioma therapy is recommended. We carried out a new adjuvant therapy that was individualized based on the results of the reverse transcription-polymerase chain reaction (RT-PCR) for MGMT to treat malignant gliomas. 2 Our preliminary individual adjuvant therapies (IAT) based on RT-PCR results regarding MGMT expression seemed to be more effective than conventional therapies for malignant gliomas.The level of MGMT varies widely according to the type of tumor, and even varies among tumors of the same histological classification. 5,10 Approximately 30 -50% of gliomas lack MGMT. 11 The fact that more than 50% of gliomas express MGMT limits the indications for ACNU. In our preliminary IAT, platinum (Pt)-compounds were used instead of ACNU even though Ptcompounds had not been accepted as being effective in gliomas. 12,13 To ensure IAT for gliomas, quantitative evaluation is needed for a higher initial response and prolongation of survival.We carried out the present study to determine more appropriate indications for the use of ACNU in gliomas. Real-time quantitative RT-PCR was used to re-evaluate the treated gliomas. MATERIAL AND METHODS Real-time quantitative RT-PCRIn 100 frozen sample of neuroepithelial tumors (19 low-grade neuroepithelial tumors, 28 Grade III gliomas, 41 glioblastomas, and 12 medulloblastomas), MGMT was quantitated by real-time quantitative RT-PCR using SYBR Green dye. RT-PCR was basically carried out as described previously. 14 -16 Briefly, total RNA was extracted from frozen tissue specimens weighing about 1 g, which had been homogenized using a glass Teflon homogenizer, via the guanidinium thiocyanate-phenol-chloroform single-step extraction method with Isogen (Nippon Gene, Toyama, Japan). 17 After ethanol precipitation, about 100 g of total RNA was extracted. Forty microliters of complementary deoxyribonucleic acid (cDNA) solution was synthesized from 2 g of total RNA wi...

show abstract

Section: Discussionmentioning

confidence: 99%

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

Tanaka

Kobayashi

Utsuki

et al. 2002

Intl Journal of Cancer

View full text Add to dashboard Cite

show abstract

“…As only small amounts of total cellular RNA could be extracted from the liver biopsies available for the present study, a RT-PCR method for determining individual cytokine mRNAs was applied. This method has the advantage of being both sensitive, and, when appropriate controls are used, quantitative [24][25][26].…”

Section: Discussionmentioning

confidence: 99%

Cytokine mRNA expression in the liver of patients with primary biliary cirrhosis (PBC) and chronic hepatitis B (CHB)

Shindo¹,

Mullin

Braun-Elwert

et al. 1996

Clinical and Experimental Immunology

View full text Add to dashboard Cite

SUMMARYThe expression of cytokine mRNA species was determined in liver biopsies from six normal subjects, 18 patients with PBC and 14 patients with hepatitis B e antigen (HBeAg)-positive CHB using a reverse transcriptase-polymerase chain reaction (RT-PCR) technique. cDNA, obtained by reverse transcription using oligo d(T) primers, was amplified by PCR using primers specific for the coding region of seven different cytokines (IL-1, IL-2, IL-4, IL-5, IL-6, interferon-gamma (IFN-°), tumour necrosis factoralpha (TNF-®)). The abundance of some cytokines (IL-2, IL-4, IL-5 and IFN-°) was also estimated by semiquantitative RT-PCR, using as standards dilutions of synthetic cytokine mRNA transcripts, that could be distinguished electrophoretically from respective native cytokine mRNAs. Hepatic inflammation was assessed by a semiquantitative histologic score and by amplification of mRNA for T cell receptor (TCR)-®. mRNAs for IL-1 and IL-6 were detected in only one control liver. In CHB, mRNAs for IL-1, IL-2, IL-4, IL-5 and IFN-°were detected in 43%, 60%, 80%, 20%, and 54% of biopsies, respectively. mRNA for IFN-°and IL-4, but not IL-1, tended to be associated with severe inflammation. In five biopsies semiquantitative analyses revealed increased levels of mRNA for TCR-® and, when transcripts were detectable, high levels of mRNA for IFN-°and IL-4. In PBC, mRNA for IFN-°was detected in 60% of biopsies, but no mRNAs for IL-1, IL-2, IL-4, IL-5, or IL-6, or for TNF-®, were detected. Semiquantitative analyses revealed that absolute levels of mRNA for IFN-°tended to correlate with the severity of hepatic inflammation. The results suggest that: (i) there may be fundamental differences in the roles that cytokines play in the hepatic inflammatory processes of PBC and CHB; and (ii) while hepatic IFN-°mRNA expression is not specific for PBC, IFN-°may play a prominent role in the immunopathogenesis of PBC.

show abstract

“…The levels of rat ECE-I~ and -lfl transcripts were measured by competitive PCR [13] using their respective cDNAs, which were reverse-transcribed from RNA samples. The 5'-terminal regions of rat ECE-1 e and -lfl cDNAs were synthesized by PCR using a sense primer (ATGATGTCATCCTACAAGCGGGCC) for ECE-lc~ cDNA, a sense primer (ATGGGCAGCCTGAGGCCTCCCCAG) for ECE-lfl cDNA, and an antisense primer (GGGTCCATGGAGTTTAGGAT-GGAGCTGGT) for both cDNAs, and the PCR products (303 bp for ECE-kz and 327 bp for ECE-lfl) were subcloned into a pCR II TA vector to construct pCRrECE-I~ and pCRrECE-lfl, respectively.…”

Section: Competitive Pcr Of Rat Ece-la and -1~ Transcriptsmentioning

confidence: 99%

Identification and characterization of two isoforms of an endothelin‐converting enzyme‐1

Shimada¹,

Takahashi²,

Ikeda³

et al. 1995

FEBS Letters

118

View full text Add to dashboard Cite

. No significant difference was found in the specific activity and substrate specificity between the two isoforms. The expression level of ECE-I~ mRNA was higher than that of ECE-I~ in various rat cells and tissues, suggesting that the physiologically important isoform is ECE-la. The present findings verified the presence of two forms of ECE-1 over many species, which are created probably through alternative splicing.

show abstract

Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction.

Cited by 1,334 publications

References 13 publications

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

Cytokine mRNA expression in the liver of patients with primary biliary cirrhosis (PBC) and chronic hepatitis B (CHB)

Identification and characterization of two isoforms of an endothelin‐converting enzyme‐1

Contact Info

Product

Resources

About

Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction.

Cited by 1,334 publications

References 13 publications

O6‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

O6‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

Cytokine mRNA expression in the liver of patients with primary biliary cirrhosis (PBC) and chronic hepatitis B (CHB)

Identification and characterization of two isoforms of an endothelin‐converting enzyme‐1

Contact Info

Product

Resources

About

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas

O⁶‐methylguanine‐DNA methyltranspherase gene expression in gliomas by means of real‐time quantitative RT‐PCR and clinical response to nitrosoureas