Analysis of dofA , a fruA -Dependent Developmental Gene, and Its Homologue, dofB , in Myxococcus xanthus

Abstract

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGC CG, in developmentally regulated dofA expression is suggested.

Activation of a Development-Specific Gene, dofA , by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

“…1) (promoter Ϫ91) decreased ␤-galactosidase activity to 45% of that of the promoter up to nt Ϫ128 (promoter Ϫ128), and the deletion of region b (promoter Ϫ62) and region a (promoter Ϫ41) decreased its activity to 13% and 4%, respectively. These results agree well with the results previously described (8). Therefore, regions a and b were important for the developmental regulation of dofA expression.…”

“…The fruA gene is essential for development, and the dofA gene is not (8). Therefore, FruA appears to regulate other genes that are essential for development.…”

“…Therefore, regions a and b were important for the developmental regulation of dofA expression. It is worth noting that the spacing between regions a and b was unimportant, since deletion of the region from nt Ϫ68 to Ϫ60 had no effect (8).…”

“…Since the region from nucleotides (nt) Ϫ128 to Ϫ57 with respect to the transcription initiation site is sufficient for the developmental induction of dofA (8), for gel shift assays, DNA fragments containing the dofA promoter region from nt Ϫ150 to Ϫ32 were amplified by PCR with the chromosomal DNA of M. xanthus DZF1 and oligonucleotide primers Ϫ150T and Ϫ32B (Fig. 1).…”

Mutational Analysis of the Myxococcus xanthus Ω4406 Promoter Region Reveals an Upstream Negative Regulatory Element That Mediates C-Signal Dependence

“…This prevented us from determining whether FruA counteracts the negative effect of the upstream element. In the absence of the upstream element, ⍀4406 regulation is like that of a few other M. xanthus genes, including tps and dofA, whose expression depends on FruA but not on C signaling (14,15,23,34).…”