Analysis of Streptococcal Infection and Correlation with Climatic Factors in Cultured Tilapia Oreochromis spp. in Taiwan

Abstract

Tilapia (Oreochromis spp.), a prominent warm water food fish, is one of the major fish species grown in the aquaculture industry in south-east Asia. Tilapia can tolerate adverse water quality and other stressors, like diverse salinity and fluctuation of pH value, better than most other commercial aquaculture species. Environmental fluctuations are one of the main factors that affect the outbreak of infectious diseases in cultured tilapia. Cultured tilapia in Taiwan appears to be more susceptible to infections caused by Streptococci during the summer season. The present study emphasizes the Streptococcus spp. infection in tilapia in Taiwan and is the first study on the analysis of the potential impact of climate change on streptococcal infection in cultured tilapia in Asia. The data collected from the treatment and diagnosis system (TDS) of the aquatic animal diseases database from 2006 to 2015 were used to analyze the endemic streptococcal infection and the effect of climatic factors. Based on the results, the factor, average atmospheric pressure, is negatively correlated to streptococcal infection, while the other three, including average temperature, ultraviolet (UV) index, and rainfall, are positively correlated to streptococcal infection. A multivariate logistic regression model with these four factors was also built. When the average temperature is above 27.0 °C, the average atmospheric pressure is lower than 1005.1 hPa, or the UV index is above 7.2, the percentage of cumulated positive farms from all submitted tilapia cases was more than 50%. In addition, within 3 days of rain, rainfall is relevant to the occurrence of Streptococcus in tilapia. Using TDS to alert the occurrence of streptococcal infection in tilapia can be a very useful tool for veterinary aquatic animal inspection stations, and reducing economic losses and labour costs in aquatic agriculture.

Fatal Streptococcus iniae Infection in a Juvenile Free-Ranging Short-Beaked Common Dolphin (Delphinus delphis)

“…The factors leading to S. iniae infection in this dolphin are not well understood, and climatic factors must be considered. Outbreaks of S. iniae infections in farmed fish have been linked to environmental fluctuations and rain fall events [ 25 ]. This dolphin was found deceased on a suburban beach near the end of winter (August, Southern hemisphere).…”

Phenotype, genotype and pathogenicity of Streptococcus agalactiae isolated from cultured tilapia (Oreochromis spp.) in Taiwan

“…Yunlin, Chiayi, Kaohsiung and Pingtung, as shown in Figure 1. The strains were confirmed by detecting a 460‐bp fragment using the primers: forward (SA‐GAPDH‐F2 5′‐ACAACACATCCATGAAAATG) and reverse (SA‐GAPDH‐R1 5′‐ATTTACTTCTTCGACAGTTACGTC) (Liao et al., 2020). The PCR conditions were as follows: 5 min at 95°C; 30 cycles of 30 s at 95°C, 35 s at 53°C and 1 min at 72°C; and final extension for 10 min at 72°C.…”

“…agalactiae infection are an accumulation of serosanguineous fluid in the abdominal cavity, visceral organ enlargement, congestion or haemorrhage, and meningitis (Zamri-Saad et al, 2010). The severity of the disease depends on the virulence factors such as virulence genes and water temperature (Doran et al, 2003;Liao et al, 2020). Several antibiotics may be used to prevent streptococcal infection, but frequent and improper usage leads to antimicrobial resistance (Darwish et al, 2002;Deng et al, 2019;Shiomitsu et al, 1980).…”

Tilapia Farming in Bangladesh: Adaptation to Climate Change

“…On the other hand, novel effective vaccines can also play an important role in disease prevention and control: vaccines have been developed against most common pathogens of tilapia-Streptococcosis [168,169], motile aeromonad septicemia [170], tilapia lake virus [171], and infectious hematopoietic necrosis virus [172]. Using a treatment and diagnosis system to alert farmers to the occurrence of bacterial infection in tilapia can be a very useful tool that can reduce economic losses and labor costs in aquaculture [173].…”