Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

Abstract

DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N 6 -ethenoadenine (eA) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their eA activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

Interplay between base excision repair activity and toxicity of 3-methyladenine DNA glycosylases in an E. coli complementation system

“…1), suggesting that optimal fitness depends on a window of 3MeA glycosylase activity. The sp Mag1 D170N mutation, which substantially decreases sp Mag1 enzymatic activity without abolishing it [13], moderately increased survival of MV1932 cells over both an empty vector and wild-type sp Mag1 (Fig. 1).…”

“…S. cerevisiae MAG (RefSeq NM 001179032.1) was cloned using the primers AAAAAACTCGAGATGGGTTCTTCTCAC (F) and AAAAA– AAAGCTTTTAGGATTTCACGAA (R) and S. pombe Mag1 (RefSeq NM 001019417.2) using the primers AAAAAACTCGAGATGGGTTCTTCTCAC (F) and AAAAAAAAGCTTTCAGTGTTTCTTCGG (R), using previously described sp Mag1 and sc MAG plasmids as PCR templates [13]. All constructs were transformed into an F’ (fertility plasmid) positive MV1932 strain of E .…”

“…sp Mag1 proteins (wild-type and K126N E130G N175D mutant) were purified as previously described [13]. Briefly, proteins were overexpressed in E. coli as N-terminal His-tagged constructs and purified by affinity chromatography.…”

“…In vitro base excision activity of 3MeA, 7MeG and εA was performed as described previously [13]. Briefly, 7MeG and εA excision was measured by alkaline cleavage of the abasic site product generated from sp Mag1 incubation with the 25mer oligonucleotide d(GACCACTACACCXTTTCCTAACAAC)/d(GTTGTTAGGAAACGGTGT-AGTGGTC), in which × denotes the position of 7MeG or εA.…”

“…By contrast, the Saccharomyces cerevisiae ortholog, sc MAG, is inducible, repairs a broader set of alkylation lesions than sp Mag1, and its deletion has a profound effect on S. cerevisiae alkylation resistance, similar to E. coli alkA [4,13–16]. Thus, constitutively expressed 3MeA glycosylases tend to have narrower substrate specificity and less overall impact on alkylation resistance than inducible ones.…”