Angiotensin (1-7) Decreases Myostatin-Induced NF-κB Signaling and Skeletal Muscle Atrophy

Aravena, Javier; Ábrigo, Johanna; González, Francisco; Aguirre, Francisco; González, Andrea; Simón, Felipe; Cabello-Verrugio, Claudio

doi:10.3390/ijms21031167

Cited by 27 publications

(28 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This finding corroborates another study showing that p38MAPK signaling is a regulator of FGF23, in part through pro-inflammatory transcription factor complex NFκB [10]. Importantly, NFκB is a downstream target of myostatin [1] and itself is an important mediator of the stimulatory effect of inflammation and pro-inflammatory cytokines on FGF23 synthesis [22,47]. NFκB is effective through inducing SOCE [47].…”

Section: Discussionsupporting

confidence: 89%

Myostatin regulates the production of fibroblast growth factor 23 (FGF23) in UMR106 osteoblast–like cells

Ewendt

Feger

Föller

2021

Pflugers Arch - Eur J Physiol

View full text Add to dashboard Cite

Myostatin is a signaling molecule produced by skeletal muscle cells (myokine) that inhibits muscle hypertrophy and has further paracrine and endocrine effects in other organs including bone. Myostatin binds to activin receptor type 2B which forms a complex with transforming growth factor-β type I receptor (TGF-βRI) and induces intracellular p38MAPK and NFκB signaling. Fibroblast growth factor 23 (FGF23) is a paracrine and endocrine mediator produced by bone cells and regulates phosphate and vitamin D metabolism in the kidney. P38MAPK and NFκB-dependent store-operated Ca2+ entry (SOCE) are positive regulators of FGF23 production. Here, we explored whether myostatin influences the synthesis of FGF23. Fgf23 gene expression was determined by qRT-PCR and FGF23 protein by ELISA in UMR106 osteoblast–like cells. UMR106 cells expressed activin receptor type 2A and B. Myostatin upregulated Fgf23 gene expression and protein production. The myostatin effect on Fgf23 was significantly attenuated by TGF-βRI inhibitor SB431542, p38MAPK inhibitor SB202190, and NFκB inhibitor withaferin A. Moreover, SOCE inhibitor 2-APB blunted the myostatin effect on Fgf23. Taken together, myostatin is a stimulator of Fgf23 expression in UMR106 cells, an effect at least partially mediated by downstream TGF-βRI/p38MAPK signaling as well as NFκB-dependent SOCE.

show abstract

Section: Discussionsupporting

confidence: 89%

Myostatin regulates the production of fibroblast growth factor 23 (FGF23) in UMR106 osteoblast–like cells

Ewendt

Feger

Föller

2021

Pflugers Arch - Eur J Physiol

View full text Add to dashboard Cite

show abstract

“…There are a number of studies showing that Mstn is a ROS-inducing myokine in skeletal muscles. Mstn treatment resulted in a drastic increase of intracellular ROS content of C2C12 myotubes [ 152 ]. This ROS generation is initiated via the MAPKs (p38 and ERK) signaling pathway, which ultimately triggered oxidative stress-dependent muscle wasting [ 153 ].…”

Section: Myokines and Oxidative Stressmentioning

confidence: 99%

Mitochondria Homeostasis and Oxidant/Antioxidant Balance in Skeletal Muscle—Do Myokines Play a Role?

Pang¹,

Chan²,

Chan³

2021

Antioxidants

View full text Add to dashboard Cite

Mitochondria are the cellular powerhouses that generate adenosine triphosphate (ATP) to substantiate various biochemical activities. Instead of being a static intracellular structure, they are dynamic organelles that perform constant structural and functional remodeling in response to different metabolic stresses. In situations that require a high ATP supply, new mitochondria are assembled (mitochondrial biogenesis) or formed by fusing the existing mitochondria (mitochondrial fusion) to maximize the oxidative capacity. On the other hand, nutrient overload may produce detrimental metabolites such as reactive oxidative species (ROS) that wreck the organelle, leading to the split of damaged mitochondria (mitofission) for clearance (mitophagy). These vital processes are tightly regulated by a sophisticated quality control system involving energy sensing, intracellular membrane interaction, autophagy, and proteasomal degradation to optimize the number of healthy mitochondria. The effective mitochondrial surveillance is particularly important to skeletal muscle fitness because of its large tissue mass as well as its high metabolic activities for supporting the intensive myofiber contractility. Indeed, the failure of the mitochondrial quality control system in skeletal muscle is associated with diseases such as insulin resistance, aging, and muscle wasting. While the mitochondrial dynamics in cells are believed to be intrinsically controlled by the energy content and nutrient availability, other upstream regulators such as hormonal signals from distal organs or factors generated by the muscle itself may also play a critical role. It is now clear that skeletal muscle actively participates in systemic energy homeostasis via producing hundreds of myokines. Acting either as autocrine/paracrine or circulating hormones to crosstalk with other organs, these secretory myokines regulate a large number of physiological activities including insulin sensitivity, fuel utilization, cell differentiation, and appetite behavior. In this article, we will review the mechanism of myokines in mitochondrial quality control and ROS balance, and discuss their translational potential.

show abstract

“…Thirty to eighty micrograms of proteins from TA muscles were used for Western blot analyses. The samples were separated by SDS-PAGE, transferred to PVDF membranes, and subjected to immunoblotting as previously described [56]. The primary antibodies used were mouse anti-MHC (1:1000 MF-20; Developmental Studies, Hybridoma Bank, University of Iowa, Iowa, IA, USA), mouse anti-troponin I (1:1000; Cell Signaling, Danvers, MA, USA), myosin type IIb (1:1000, BF-F3; Developmental Studies, Hybridoma Bank, University of Iowa, Iowa, IA, USA), rabbit anti-atrogin-1 (1:500, ECM Biosciences, Versailles, KY, USA), rabbit anti-MuRF-1 (1:500, ECM Biosciences, Versailles, KY, USA), goat anti-4-hydroxynonenal (4-HNE) (1:1000; Merck, Temecula, CA, USA), mouse anti-ubiquitin (1:5000, Santa Cruz, Dallas, TX, USA), and rabbit anti-β-actin (1:2000, Abcam, Cambridge, MA, USA).…”

Section: Western Blotmentioning

confidence: 99%

“…Total RNA was extracted from TA muscles using Chomczynski's solution, and the purified RNA was transcribed into cDNA for standard methods, as we have previously described [56]. The cDNA obtained from reverse transcription was analyzed to evaluate the TGR5 gene expression (forward: CAGGAGGCCATAAACTTCCA; reverse: GTCAGCTCCCTGTTCTTTGC) with SyBR Green using 18S (forward: GTAACCCGTTGAACCCCATT; reverse: CCATCCAATCGGTAGTAGCG) as a housekeeping gene.…”

Section: Rt-qpcrmentioning

confidence: 99%

Sarcopenia Induced by Chronic Liver Disease in Mice Requires the Expression of the Bile Acids Membrane Receptor TGR5

Ábrigo

Campos

González

et al. 2020

IJMS

Self Cite

View full text Add to dashboard Cite

Sarcopenia is a condition of muscle dysfunction, commonly associated with chronic liver disease (CLD), characterized by a decline in muscle strength, the activation of the ubiquitin-proteasome system (UPS), and oxidative stress. We recently described a murine model of CLD-induced sarcopenia by intake of hepatotoxin 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC), which presents an increase in plasma bile acids (BA). BA induced skeletal muscle atrophy through a mechanism dependent on the Takeda G protein-coupled receptor 5 (TGR5) receptor. In the present study, we evaluated the role of TGR5 signaling in the development of sarcopenia using a model of DDC-induced CLD in C57BL6 wild-type (WT) mice and mice deficient in TGR5 expression (TGR5−/− mice). The results indicate that the decline in muscle function and contractibility induced by the DDC diet is dependent on TGR5 expression. TGR5 dependence was also observed for the decrease in fiber diameter and sarcomeric proteins, as well as for the fast-to-slow shift in muscle fiber type. UPS overactivation, indicated by increased atrogin-1/MAFbx (atrogin-1) and muscle RING-finger protein-1 (MuRF-1) protein levels and oxidative stress, was abolished in tibialis anterior muscles from TGR5−/− mice. Our results collectively suggest that all sarcopenia features induced by the DDC-supplemented diet in mice are dependent on TGR5 receptor expression.

show abstract

Angiotensin (1-7) Decreases Myostatin-Induced NF-κB Signaling and Skeletal Muscle Atrophy

Cited by 27 publications

References 58 publications

Myostatin regulates the production of fibroblast growth factor 23 (FGF23) in UMR106 osteoblast–like cells

Myostatin regulates the production of fibroblast growth factor 23 (FGF23) in UMR106 osteoblast–like cells

Mitochondria Homeostasis and Oxidant/Antioxidant Balance in Skeletal Muscle—Do Myokines Play a Role?

Sarcopenia Induced by Chronic Liver Disease in Mice Requires the Expression of the Bile Acids Membrane Receptor TGR5

Contact Info

Product

Resources

About