Animal Brucellosis: Seropositivity rates, Isolation and Molecular Detection in Southern and Central Ethiopia

Wakjira, Bayeta Senbata; Sarba, Edilu Jorga; Lakew, Matios; Olani, Abebe; Tadesse, Biniam; Tuli, Getachew; Belaineh, Redeat; Abera, Shubisa; Kinfe, Getachew; Gebre, Solomon

doi:10.2147/vmrr.s372455

Cited by 4 publications

(2 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In animals vaccinated with RB51, the RB, SAT, SAT-2Me, and FPA tests showed negative results in all months of diagnosis, proving that the antibodies induced by RB51 cannot be detected (there is no antigen-antibody interaction) by the diagnostic screening tests for bovine brucellosis [34]. Thus, in cattle herds where the RB51 vaccine strain is used correctly, the use of diagnostic screening tests, such as RB, could be considered unequivocally.…”

Section: Discussionmentioning

confidence: 99%

Comparison of diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 strain vaccines

Ibarra,

Campos,

Hernán

et al. 2023

Vet World

View full text Add to dashboard Cite

Background and Aim: The diagnosis of bovine brucellosis in animals vaccinated with strain-19 (S19) and Rose Bengal (RB)-51 strain vaccines can be misinterpreted due to false positives. This study aimed to compare diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 vaccine strains. Materials and Methods: Two groups of 12 crossbred Holstein calves between 6 and 8 months of age were used. On day 0, blood samples were collected from the animals, and the competitive enzyme-linked immunosorbent assay was used for serological diagnosis of bovine Brucellosis. All animals tested negative. After the first blood collection, the animals were subcutaneously vaccinated: one group received the S19 vaccine and the other received the RB51 vaccine. From the 3rd month after vaccination, all animals were sampled. Sampling was repeated every 2 months until the 7th month. Serological diagnosis of bovine brucellosis was performed using RB, tube serum agglutination test (SAT), SAT with 2-mercaptoethanol (SAT-2Me), and fluorescence polarization assay (FPA). Results: Animals vaccinated with S19 showed positive results with the RB, SAT, and SAT-2Me tests in all months of post-vaccination diagnosis. In animals vaccinated with S19, FPA showed positive results at months 3 and 5 and negative results at month 7, indicating that this test discriminates vaccinated animals from infected animals 7 months after vaccination. Rose Bengal, SAT, SAT-2Me, and FPA tests showed negative results in animals vaccinated with RB51 in all months of diagnosis. Conclusion: Animals vaccinated with S19 may test positive for brucellosis using RB, SAT, or SAT-2Me tests 7 months later. Fluorescence polarization assay is an optimal alternative for diagnosing animals in the field, thereby preventing false positives, and consequently, unnecessary confiscations of animals. Animals vaccinated with RB51 tested negative with RB, SAT, SAT-2Me, and FPA tests in all months of diagnosis, confirming that the tests are ineffective for diagnosing brucellosis caused by rough strains. Keywords: agglutination, bovine, brucellosis, vaccination.

show abstract

Section: Discussionmentioning

confidence: 99%

Comparison of diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 strain vaccines

Ibarra,

Campos,

Hernán

et al. 2023

Vet World

View full text Add to dashboard Cite

show abstract

“…Bacterial DNA was analyzed by RT-PCR with the IS711 primer probe. Amplification of the Brucella DNA genus was in Bayeta et al 25 Using (forward: GCTTGAAGCTTGCGGACAGT) and (reverse: GGCCTACCGCTGCGAAT), probe (5'-6-FAM-AAGC-CAACACCCGGCCATTATGGT-TAMRA 3') (Invitrogen, Thermo Fisher Scientific, Waltham, Massachusetts, USA). Total mix volume was 15 μL/sample containing: Master mix 3 μL (Applied Biosystems, Waltham, Massachusetts, USA), 0.3 μL for each forward and reverse primer, 0.1 μL of the labelled probe, and 3.5 μL DNA and water to make up the total volume.…”

Section: Real-time Pcr and Conventional Pcr Assaymentioning

confidence: 99%

Identification of Brucella melitensis from camel’s blood by vitek2 and real time polymerase chain reaction

Manivannan,

Ramasamy,

Sundaresan

et al. 2024

Eur J Clin Exp Med

View full text Add to dashboard Cite

Introduction and aim. Brucellosis is a zoonotic disease. Experimental clinical and laboratory diagnosis is still facing problems in identifying the organism. The present study will diagnose a Brucella infection in camel blood in Qatar using serological assays. Isolation and identification were performed on a camel blood sample. Brucella in bacterial isolates was determined by real-time polymerase chain reaction (RT-PCR) as a gold standard test. Material and methods. A total of 220 samples, 200 random serum samples, and 20 EDTA blood samples were selected among the above-mentioned random samples, and 20 serum samples from camel handlers were collected from Al Shahaniya prov ince, Qatar. The Rose Bengal test (RBT), buffered antigen plate agglutination test (BAPAT), and enzyme linked immunosorbent assay (cELISA) for the monoclonal antibody in serum samples were performed using commercially available kits. For the molecular detection of Brucella, conventional PCR and real-time PCR (GPS kit) were used for the genus-specific insertion sequence IS711. Brucella melitensis (MICROBOSS Hightech GmbH kit) was used to identify subspecies. Results. The results identified by vitek2 compact (30%) showed B. melitensis in 6 samples out of 20 isolates. Both conventional (66.67%) and RT-PCR (83.33%) analyses supported this, demonstrating the presence of Brucella. These tests also showed that Brucella species were present in Rose Bengal 182/200 (91%), BAPAT 182/200 (91%), and cELISA (90%) 180/200 in camel serum. Conclusion. To conclude, the prevalence of brucellosis in dromedary camels is higher in this region, and as a matter of urgency, measures should be taken to control the disease.

show abstract

Human and animal brucellosis and risk factors for human infection in Ethiopia: a systematic review and meta-analysis (2015–2024)

Dagnaw,

Mamuye,

Dejene

2024

BMC Public Health

View full text Add to dashboard Cite

Background and objective Brucellosis is a neglected zoonotic disease caused by Brucella species. Unlike most developed nations, the problem of brucellosis in Ethiopia remains a public and animal health concern. This study was conducted to determine the magnitude of brucellosis in animals (mainly cattle, sheep, goats, dogs and camels) and humans, and to identify the risk factors for human brucellosis. Methodology The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were followed to conduct this systematic review and meta-analysis, which was performed from May 2024 to July 2024. Academic databases such as PubMed, ScienceDirect, Scopus, PubMed Central, Web of Science, and Google Scholar were searched to identify articles focusing on brucellosis in humans and animals in Ethiopia. Data extraction was performed according to predefined inclusion and exclusion criteria. The included articles were appraised using the appraisal tool for cross-sectional studies to assess study quality. Publication bias and small study effects were examined using funnel plot observation and Egger’s test, respectively. Statistical analysis was conducted using R software version 4.4.1. Results Thirty-nine articles published between 2015 and 2024 were included in the final analysis from a total of 1,427 identified articles. The overall pooled seroprevalence of brucellosis was 5.0% (95% CI: 3.0, 6.0). The seroprevalence of brucellosis was higher in humans at 6.9% (95% CI: 4.9, 8.8) and lower in cattle at 3.5% (95% CI: 2.2, 4.7). There was high heterogeneity in the reports of brucellosis seroprevalence between studies (τ² = 0.0038, H² = 255.9, I² = 99.61%, Q-test = 1954.99, df = 56, p ≤ 0.001). Laboratory tests and study location were identified as factors contributing to potential sources of variation in the pooled seroprevalence. Drinking raw milk from aborted animals, touching aborted materials or fetuses, and occupation were among the risk factors for human brucellosis. No publication bias or small study effects were detected. Conclusion The findings indicate that brucellosis continues to pose a significant zoonotic threat, particularly to humans, where the seroprevalence is notably higher than in animals. These results highlight the need for targeted public health interventions and greater awareness to reduce the incidence of brucellosis, especially among high-risk populations. Supplementary Information The online version contains supplementary material available at 10.1186/s12889-024-21042-2.

show abstract

Animal Brucellosis: Seropositivity rates, Isolation and Molecular Detection in Southern and Central Ethiopia

Cited by 4 publications

References 21 publications

Comparison of diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 strain vaccines

Comparison of diagnostic tests for detecting bovine brucellosis in animals vaccinated with S19 and RB51 strain vaccines

Identification of Brucella melitensis from camel’s blood by vitek2 and real time polymerase chain reaction

Human and animal brucellosis and risk factors for human infection in Ethiopia: a systematic review and meta-analysis (2015–2024)

Contact Info

Product

Resources

About