Antiviral drug screen identifies DNA-damage response inhibitor as potent blocker of SARS-CoV-2 replication

Abstract

SARS-CoV-2 has currently precipitated the COVID-19 global health crisis. We developed a medium-throughput drug screening system and identified a small molecule library of 34 of 430 protein kinase inhibitors that were capable of inhibiting SARS-CoV-2 cytopathic effect in human epithelial cells. These drug inhibitors are in various stages of clinical trials. We detected key proteins involved in cellular signaling pathways mTOR-PI3K-AKT, ABL-BCR/MAPK, and DNA-Damage Response that are critical for SARS-CoV-2 infection. A drug-protein interaction based secondary screen confirmed compounds such as the ATR kinase inhibitor berzosertib and torin2 with anti SARS-CoV-2 activity. Berzosertib exhibited potent antiviral activity against SARS-CoV-2 in multiple cell types and blocked replication at post-entry step. Berzosertib inhibited replication of SARS-CoV-1 and MERS-CoV as well. Our study highlights key promising kinase inhibitors to constrain coronavirus replication as a host-directed therapy in the treatment of COVID-19 and beyond as well as provides an important mechanism of host-pathogen interactions.

Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp13 helicase

“…Its cytotoxicity is probably caused by inhibition of this compound's original cellular target Akt as Akt signalling is shown to be important for cell survival ( Figure 5B,C and Supplementary Figure S11A) [ 55 ]. Interestingly, PI3K/Akt/mTOR signalling inhibition has been demonstrated to suppress SARS-CoV-2 replication in mammalian cells [ 62 , 63 ]. From the current study, we cannot elucidate whether FPA-124 inhibits viral growth by inhibiting nsp13 activity, modulating Akt signalling or a combination of both mechanisms.…”

ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signaling

“…Human ACE2 coding sequence was cloned into a lentiviral vector as described (Garcia et al, 2021). sgRNAs targeting human ORAI1 (Forward primer: CACCGGATCGGCCAGAGTTACTCC ; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC ) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG ; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC ) genes were subcloned into pLentiguide puro (Addgene).…”

Human Stem Cell Models of SARS-CoV-2 Infection in the Cardiovascular System

“…Currently, hPSCs have already shown great promise in several SARS-CoV-2 studies focused on the lungs, heart, gut, and pancreas [ 78 ]. For example, in combination with in vivo and in silico models, hPSC-CMs have demonstrated significant value in elucidating the mechanisms of viral entry, cell death, and cytokine storm for indirect effects related to SARS-CoV-2 infection in neighboring cells and organs [ 40 , 92 , 95 – 97 ]. In addition, hPSCs exhibit powerful implications for SARS-CoV-2 clinical studies involving cell therapy or high throughput drug screening.…”

“…hPSC-CMs have also shown strong potential as model for assessing the cardiac safety of new drugs against SARS-CoV-2 [ 94 ]. Several reports have used hPSC-CMs to investigate SARS-CoV-2 infection in clinical perspectives [ 95 – 97 ]. Marchiano et al indicated that SARS-CoV-2 infection changed the electrophysiological properties of hPSC-CMs by decreasing electrical conduction velocity and depolarization spike amplitude [ 96 ].…”

“…Marchiano et al indicated that SARS-CoV-2 infection changed the electrophysiological properties of hPSC-CMs by decreasing electrical conduction velocity and depolarization spike amplitude [ 96 ]. In order to assess the antiviral effects of a panel of protein kinase inhibitors, Garcia et al screened these compounds and found that berzosertib, an ATR kinase inhibitor, showed considerable efficacy against SARS-CoV-2 in hPSC-CMs [ 95 ]. Lastly, Mills et al utilized human PSC-derived cardiac organoids to test bromodomain protein (BRD) inhibitors against BRD4 which was an intracellular mediator of cardiac dysfunction from SARS-CoV-2 induced cytokine over-activation.…”