AP2M1 mediates autophagy-induced CLDN2 (claudin 2) degradation through endocytosis and interaction with LC3 and reduces intestinal epithelial tight junction permeability

Ganapathy, Ashwinkumar Subramenium; Saha, Kushal; Suchanec, Eric; Singh, Vikash; Verma, Aayush; Yochum, Gregory S.; Koltun, Walter A.; Nighot, Meghali; Ma, Thomas; Nighot, Prashant K.

doi:10.1080/15548627.2021.2016233

Cited by 44 publications

(34 citation statements)

References 74 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As previously described, the control and starvation-induced samples were prepared for immune-gold staining and TEM. 11…”

Section: Methodsmentioning

confidence: 99%

“…Single guide RNA (sgRNA) targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 ( MAPK-3 ) or CGCGGGCAGGTGTTCGACGT region of ERK-2 ( MAPK-1 ) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN -/-, MAPK dKO , ATG7 -/- and Scr Caco-2 cells as discussed previously. 11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen, 11668027) as per the manufacturer’s instructions.…”

Section: Methodsmentioning

confidence: 99%

“…T5648; 20 mg/ml suspended in 98% sunflower seed oil and 2% ethanol mixture) to 10-week-old mice as described previously. 11 The wildtype C57BL/6J mice (Stock No. 000664, Jackson Laboratory) were treated with rapamycin (40 mg/kg/day for 3 days, i.p injection).…”

Section: Methodsmentioning

confidence: 99%

“…Tissues were ascribed as normal or diseased by the Department of Pathology and Laboratory medicine, Penn State College of Medicine. Tissues were processed as described previously 11 and incubated in the presence and absence of 300 nM Rapamycin (Alfa Aesar, J62473) with or without 25 μM U0126 or 20 μM PD98059.…”

Section: Methodsmentioning

confidence: 99%

“…7–9 In our previous work, we demonstrated the autophagy pathway’s TJ barrier protective role through the clathrin-mediated degradation of the poreforming protein claudin-2. 10, 11…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Autophagy Increases Occludin Levels to Enhance Intestinal Paracellular Tight Junction Barrier

Saha

Ganapathy

Wang

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

Background and Aim: Functional loss of paracellular tight junction (TJ) barrier of the gut epithelium and mutations in autophagy genes are factors potentiating inflammatory bowel disease (IBD). Previously we showed the role of autophagy in enhancing the TJ barrier via claudin-2 degradation, however, its role in the regulation of the barrier-forming protein occludin remains unknown. Here, we investigate the role of autophagy in the regulation of occludin and its role in inflammation-mediated TJ barrier loss. Methods: Pharmacological and genetic tools were used to study the effect of autophagy on occludin levels and localization, and the role of the MAPK pathway. Results: Autophagy induction using pharmacological activators and nutrient starvation increased total occludin levels in different epithelial cells. Starvation enriched membrane occludin levels and reduced paracellular inulin flux in Caco-2 cells. Starvation-induced TJ barrier enhancement was contingent on the presence of occludin as OCLN-/- nullified its TJ barrier enhancing effect. Autophagy inhibited the constitutive degradation of occludin and protected against inflammation-induced TJ barrier loss. Starvation-induced TJ barrier enhancement was prevented by inhibition of autophagy. Autophagy enhanced the phosphorylation of ERK-1/2. Inhibition of these kinases in Caco-2 cells and human intestinal mucosa inhibited the protective effects of autophagy. In-vivo, autophagy induction by rapamycin increased occludin levels in mouse intestines and protected against LPS and TNF-α-induced TJ barrier loss. Additionally, acute Atg7 knockout in adult mice decreased intestinal occludin levels, increasing baseline colonic TJ-permeability and exacerbating the effect of DSS-induced colitis. Conclusion: Our data suggest a novel role of autophagy in promoting the intestinal TJ barrier by increasing occludin levels in an ERK1/2 MAPK-dependent mechanism.

show abstract

“…As previously described, the control and starvation-induced samples were prepared for immune-gold staining and TEM. 11…”

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

“…7–9 In our previous work, we demonstrated the autophagy pathway’s TJ barrier protective role through the clathrin-mediated degradation of the poreforming protein claudin-2. 10, 11…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Autophagy Increases Occludin Levels to Enhance Intestinal Paracellular Tight Junction Barrier

Saha

Ganapathy

Wang

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

Self‐Adjuvanting Bacteria Hydrogel for SHP1 Checkpoint Inhibition in Tumor‐Draining Lymph Nodes to Enhance Cancer Immunotherapy

Pan,

Liu,

Kang

et al. 2024

Adv Funct Materials

View full text Add to dashboard Cite

Despite recent advances in immunotherapy, its efficacy remains constrained by the absence of immune coordination. Especially, the interplay between tumor‐draining lymph nodes (TDLNs) and tumors is frequently disregarded. Here, a self‐adjuvanting hydrogel capable of eliciting a powerful and sustained immune response is developed. Briefly, the engineered arabinose response bacteria (ARB) expressing IL‐15 and mannose‐modified hollow mesoporous Prussian blue nanoparticles (NPs) loaded with vitamin E (Man/HMPB(VE), MHV) are mixed with arabinose hydrogel (AraGel), forming the system designated as AraGel@ARB/MHV (AAM). Employing mild photothermal therapy mediated by MHV, immunogenic cell death (ICD) triggers the release of tumor‐associated antigens. Subsequently, Man‐modified NPs target TDLNs and release VE, which suppresses the checkpoint Src homology region 2 domain‐containing phosphatase‐1 (SHP1) in dendritic cells, thereby enhancing antigen presentation and T cell activation. Meanwhile, IL‐15 expression of ARB(IL‐15) induced by AraGel degradation enables ARB to serve as an enhanced adjuvant in a self‐adjuvanting manner, working synergistically with ICD and TDLN reprogramming to promote cytotoxic T lymphocytes activation. The hydrogel system efficiently suppresses tumor growth by eliciting prolonged and powerful immunotherapy in an orchestrated manner. Overall, the self‐adjuvanting hydrogel holds great potential for cancer immunotherapy.

show abstract

Sonodynamic Therapy of NRP2 Monoclonal Antibody‐Guided MOFs@COF Targeted Disruption of Mitochondrial and Endoplasmic Reticulum Homeostasis to Induce Autophagy‐Dependent Ferroptosis

Zhao,

Wu,

Liang

et al. 2023

Advanced Science

View full text Add to dashboard Cite

The lethality and chemotherapy resistance of pancreatic cancer necessitates the urgent development of innovative strategies to improve patient outcomes. To address this issue, we designed a novel drug delivery system named GDMCN2,which uses iron‐based metal organic framework (Fe‐MOF) nanocages encased in a covalent organic framework (COF) and modified with the pancreatic cancer‐specific antibody, NRP2. After being targeted into tumor cells, GDMCN2 gradually release the sonosensitizer sinoporphyrin sodium (DVDMS) and chemotherapeutic gemcitabine (GEM) and simultaneously generated reactive oxygen species (ROS) under ultrasound (US) irradiation. This system can overcome gemcitabine resistance in pancreatic cancer and reduce its toxicity to non‐targeted cells and tissues. In a mechanistic cascade, the release of ROS activates the mitochondrial transition pore (MPTP), leading to the release of Ca2+ and induction of endoplasmic reticulum (ER) stress. Therefore, microtubule‐associated protein 1A/1B‐light chain 3 (LC3) is activated, promoting lysosomal autophagy. This process also induces autophagy‐dependent ferroptosis, aided by the upregulation of Nuclear Receptor Coactivator 4 (NCOA4). This mechanism increases the sensitivity of pancreatic cancer cells to chemotherapeutic drugs and increases mitochondrial and DNA damage. The findings demonstrate the potential of GDMCN2 nanocages as a new avenue for the development of cancer therapeutics.

show abstract

AP2M1 mediates autophagy-induced CLDN2 (claudin 2) degradation through endocytosis and interaction with LC3 and reduces intestinal epithelial tight junction permeability

Cited by 44 publications

References 74 publications

Autophagy Increases Occludin Levels to Enhance Intestinal Paracellular Tight Junction Barrier

Autophagy Increases Occludin Levels to Enhance Intestinal Paracellular Tight Junction Barrier

Self‐Adjuvanting Bacteria Hydrogel for SHP1 Checkpoint Inhibition in Tumor‐Draining Lymph Nodes to Enhance Cancer Immunotherapy

Sonodynamic Therapy of NRP2 Monoclonal Antibody‐Guided MOFs@COF Targeted Disruption of Mitochondrial and Endoplasmic Reticulum Homeostasis to Induce Autophagy‐Dependent Ferroptosis

Contact Info

Product

Resources

About