Application of the phylogenetic informativeness method to chloroplast markers: A test case of closely related species in tribe Hydrangeeae (Hydrangeaceae)

Mendoza, Carolina Granados; Wanke, Stefan; Salomo, Karsten; Goetghebeur, Paul; Samain, Marie‐Stéphanie

doi:10.1016/j.ympev.2012.09.029

Cited by 30 publications

(34 citation statements)

References 80 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Moreover, this study suggested that the infrageneric classification of Hydrangea proposed by McClintock (1957) is in need of revision. In a more recent study, Granados Mendoza & al. (2013) tested the utility of 13 plastid markers using a reduced sampling for resolving backbone relationships within tribe Hydrangeeae (Broussaisia not included).…”

Section: Introductionmentioning

confidence: 93%

“…-Total genomic DNA was extracted from leaf tissue using a modified CTAB method (Doyle & Doyle, 1987). Four noncoding plastid regions, previously shown to be phylogenetically informative for tribe Hydrangeeae (Granados Mendoza & al., 2013), were utilized in this study. The rpl32-ndhF intergenic spacer (IGS), trnV-ndhC IGS, trnL-rpl32 IGS and the ndhA intron were sequenced for all accessions.…”

Section: Version Of Recordmentioning

confidence: 99%

“…The rpl32-ndhF intergenic spacer (IGS), trnV-ndhC IGS, trnL-rpl32 IGS and the ndhA intron were sequenced for all accessions. Primer sequences and protocols for PCR amplification were taken from Granados Mendoza & al. (2013), with the exception of the amplification of the ndhA intron for the Asperae clade, which required the design of the additional primers ndhA-asp-F (GATTCGTTGAGACATAAATT) and ndhA-asp-R (GTACATGAGATTTTCACCT).…”

Section: Version Of Recordmentioning

confidence: 99%

“…In the present study, a comprehensive phylogeny of tribe Hydrangeeae is presented, sampling all major evolutionary clades retrieved in previous studies, using four plastid markers selected according to their phylogenetic informativeness (Granados Mendoza & al., 2013) and ITS. Using the resulting phylogenetic hypothesis, we address the polyphyletic nature of Hydrangea and evaluate the merits of creating a monophyletic Hydrangea.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Molecular phylogenetics and new (infra)generic classification to alleviate polyphyly in tribe Hydrangeeae (Cornales: Hydrangeaceae)

Smet

Mendoza

Wanke

et al. 2015

TAXON

Self Cite

View full text Add to dashboard Cite

Tribe Hydrangeeae of Hydrangeaceae currently contains nine morphologically diverse genera, many of which are well‐known garden ornamentals. Previous studies have shown eight of these genera to be phylogenetically nested within Hydrangea, rendering the latter polyphyletic. To clarify the phylogeny of tribe Hydrangeeae, the present study sequenced four chloroplast regions and ITS for an extensive set of taxa, including the type for all nine genera involved. The resulting phylogenetic hypotheses corroborate the polyphyly of Hydrangea. Since polyphyletic taxa are deemed unacceptable by both sides in the ongoing debate concerning the adherence to strict monophyly in biological classifications, a new (infra)generic classification for tribe Hydrangeeae is proposed. In order to create a stable, evolutionary informative classification a broader circumscription of the genus Hydrangea is proposed, to include all eight satellite genera of the tribe. Such treatment is considered highly preferable to an alternative where Hydrangea is to be split into several morphologically potentially unidentifiable genera. To facilitate the acceptance of the new classification proposed here, and in order to create a classification with high information content, the familiar generic names were maintained as section names where possible.

show abstract

Section: Introductionmentioning

confidence: 93%

Section: Version Of Recordmentioning

confidence: 99%

Section: Version Of Recordmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Molecular phylogenetics and new (infra)generic classification to alleviate polyphyly in tribe Hydrangeeae (Cornales: Hydrangeaceae)

Smet

Mendoza

Wanke

et al. 2015

TAXON

Self Cite

View full text Add to dashboard Cite

show abstract

“…Enormous progress has been made in the development of realistic, powerful evolutionary models for phylogenetic inference, and studies have demonstrated that using correct evolutionary models on a same data set can be essential to making correct inferences (e.g., Sullivan and Swofford, 1997;Kelsey et al, 1999;Ripplinger and Sullivan, 2010). Nonetheless, still larger gains in accuracy of inference could be obtained by optimal selection of the data to be gathered to address the phylogenetic question at hand (Goldman, 1998;Townsend et al, 2008;Tekle et al, 2010;Fong and Fujita, 2011;Moeller and Townsend, 2011;Crawley and Hilu, 2012;Horreo, 2012;Silva et al, 2012;Walker et al, 2012;Granados Mendoza et al, 2013). Furthermore, given the advance of next-generation sequencing methods, such as RAD Sequencing (Baird et al, 2008) and anchored hybrid enrichment (Lemmon et al, 2012), which allow generation of sequence data from hundreds to thousands of putatively orthologous loci, it is becoming increasingly important to either selectively generate or selectively filter the immense data sets generated by nextgeneration sequencing methods.…”

Section: Introductionmentioning

confidence: 99%

The impact of incorporating molecular evolutionary model into predictions of phylogenetic signal and noise

Wang

López-Giráldez

et al. 2014

Front. Ecol. Evol.

View full text Add to dashboard Cite

Phylogenetic inference can be improved by the development and use of better models for inference given the data available, or by gathering more appropriate data given the potential inferences to be made. Numerous studies have demonstrated the crucial importance of selecting a best-fit model to conducting accurate phylogenetic inference given a data set, explicitly revealing how model choice affects the results of phylogenetic inferences. However, the importance of specifying a correct model of evolution for predictions of the best data to be gathered has never been examined. Here, we extend analyses of phylogenetic signal and noise that predict the potential to resolve nodes in a phylogeny to incorporate all time-reversible Markov models of nucleotide substitution. Extending previous results on the canonical four-taxon tree, our theory yields an analytical method that uses estimates of the rates of evolution and the model of molecular evolution to predict the distribution of signal, noise, and polytomy. We applied our methods to a study of 29 taxa of the yeast genus Candida and allied members to predict the power of five markers, COX2, ACT1, RPB1, RPB2, and D1/D2 LSU, to resolve a poorly supported backbone node corresponding to a clade of haploid Candida species, as well as 19 other nodes that are reasonably short and at least moderately deep in the consensus tree. The use of simple, unrealistic models that did not take into account transition/transversion rate differences led to some discrepancies in predictions, but overall our results demonstrate that predictions of signal and noise in phylogenetics are fairly robust to model specification.

show abstract

Cornales (Dogwood)

Xiang

2013

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

Cornales, a relatively small, but morphologically diverse, order of flowering plants, consist of trees, shrubs, lianas, rhizomatous herbs and rarely aquatic herbs. The order represents an early divergent lineage in the Asterid clade and has a cosmopolitan distribution, occurring from cold temperate regions to the tropics, rarely in subarctic zones. Four to ten families, depending on how Cornaceae are circumscribed, comprise the order. Recent molecular phylogenetic studies supported a classification of 10 families that diverged during the late Cretaceous and early Tertiary. Many of the 10 families are small and with restricted, modern distributions, but have fossils occurring in areas outside their present distribution. Common representatives include the dogwoods (e.g., Cornus florida (flowering dogwood), Cornus kousa (kousa dogwood), Cornus canadensis (bunchberry), Cornus mas (European cornelian cherry), Cornus sericea (red‐osier dogwood), Nyssa sylvatica (black gum), Davidia involucrata (dove tree), Hydrangea macrophylla (Hydrangea), Deutzia spp. (deutzias) and Philadelphus spp. (mock oranges)), which are widely cultivated as ornamentals. Several species are medicinally important, including Cornus officinalis (cornelian cherry), Camptotheca acuminata (Happy tree), Curtisia dentata (assegai tree) and Alangium salvifolium (sage‐leaved alangium). Key Concepts: Phylogenetic studies are essential to understanding and conserving biodiversity. Phylogeny depicts evolutionary relationships of species and speciation events, providing the basis for classification and understanding macro‐ and microevolution. Including more species and molecular data in phylogenetic studies can help to clarify relationships that were obscured by morphology and difficult to resolve due to rapid radiation. The age of a lineage on a phylogeny can be estimated using molecular data with a relaxed molecular clock calibrated from fossils (referred to as divergence time estimation). Time estimation for a given lineage is substantially affected by molecular data, taxon sampling and the phylogenetic nodes calibrated by the fossils. Dated phylogeny provides the temporal framework to understand diversification patterns and speciation events in absolute historical time that can be linked to specific events in the Earth's history. Fossils are important records of past distributions of a lineage, providing data on extinction, speciation, and morphological evolution through time.

show abstract

Application of the phylogenetic informativeness method to chloroplast markers: A test case of closely related species in tribe Hydrangeeae (Hydrangeaceae)

Cited by 30 publications

References 80 publications

Molecular phylogenetics and new (infra)generic classification to alleviate polyphyly in tribe Hydrangeeae (Cornales: Hydrangeaceae)

Molecular phylogenetics and new (infra)generic classification to alleviate polyphyly in tribe Hydrangeeae (Cornales: Hydrangeaceae)

The impact of incorporating molecular evolutionary model into predictions of phylogenetic signal and noise

Cornales (Dogwood)

Contact Info

Product

Resources

About