Aquaporin1 regulates development, secondary metabolism and stress responses in Fusarium graminearum

Abstract

The Ascomycete fungus Fusarium graminearum, the causal agent of Fusarium head blight of wheat and barley, has become a predominant model organism for the study of fungal phytopathogens. Aquaporins (AQPs) have been implicated in the transport of water, glycerol, and a variety of other small molecules in yeast, plants and animals. However, the role of these proteins in phytopathogenic fungi is not well understood. Here, we identified and attempted to elucidate the function of the five aquaporin genes in F. graminearum. The phylogenetic analysis revealed that FgAQPs are divided into two clades, with FgAQP1 in the first clade. The ∆AQP1 mutant formed whitish colonies with longer aerial hyphae and reduced conidiation and perithecium formation. The ∆AQP1 mutant conidia were morphologically abnormal and appeared to undergo abnormal germination. The ∆AQP1 mutant and the wild type strain were equally pathogenic, while the mutant produced significantly higher quantities of deoxynivalenol (DON). The ∆AQP1 mutant also exhibited increased resistance to osmotic and oxidative stress as well as cell-wall perturbing agents. Using FgAQP1-GFP and DAPI staining, we found that FgAQP1 is localized to the nuclear membrane in conidia. Importantly, deletion of FgAQP1 increased the severity of conidium autophagy. Taken together, these results suggest that FgAQP1 is involved in hyphal development, stress responses, secondary metabolism, and sexual and asexual reproduction in F. graminearum. Unlike the ∆AQP1 mutant, the ∆AQP2, ∆AQP3, ∆AQP4 and ∆AQP5 mutants had no variable phenotypes.

Comparative transcriptomic analysis unveils interactions between the regulatory CarS protein and light response in Fusarium

“…Transcript levels for each gene were normalized against the tubulin beta chain gene FFUJ_04397 (CCGGTGCTGGAAACAACTG vs CGAGGACCTGGTCGACAAGT, 69 bp) and the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene FFUJ_13490 (GTGACCTCAAGGGCGTTCTG vs CGAAGATGGAGTTTGTGTT, 84 bp). FFUJ_04397 was used as a reference gene for constitutive expression in former RT-qPCR studies in Fusarium fujikuroi (see, e.g., [19, 21, 23, 28, 35]), and the GAPDH gene was recently used as an internal control in RT-qPCR studies in F. graminearum [55, 56].…”

Roles of Aquaporins in Plant-Pathogen Interaction

“…DON can interfere with normal cellular functions through inhibition of protein translation by binding to the ribosomes. In F. graminearum, the AQP protein FgAQP1 localized at the nuclear membrane was crucial for hyphal growth, sexual and asexual development, stress responses, and secondary metabolism [24]. The deletion of FgAQP1 significantly affected DON production and the expression of related genes, indicating that FgAQP1 may play key roles in F. graminearum-host interaction (Figure 2).…”

“…Some microbes, such as bacteria, show less aquaporin diversity, typically possessing only one or two AQP genes, and the absence of such genes has not revealed any definite phenotype [1]. Moreover, AQP-deletion mutants have also been studied in Botrytis cinerea and Fusarium graminearum, respectively, suggesting that AQPs also have important roles in growth, development, secondary metabolism, and pathogenicity of fungal pathogens [5,24].…”

Fungal X-Intrinsic Protein Aquaporin from Trichoderma atroviride: Structural and Functional Considerations

“…These channels facilitate the transport of water and a variety of small molecules across biological membranes, the plasmalemic and the endomembrane system, of unicellular and multicellular organisms [19]. In filamentous fungi, preliminary evidence shows that MIPs are involved in the regulation of hyphal growth, sclerotia formation, conidiation, spore germination, virulence, secondary metabolisms, and the transport of various molecules [20][21][22][23][24][25]. In this respect, the impact of transcriptional and protein regulation of MIPs on the fungus' life cycle remains a fascinating area that deserves further exploration.…”

“…In silico analysis showed that fungal XIP transports water and possibly other small polar molecules like H 2 O 2 , but intriguingly, not glycerol concerning the plant counterparts. However, unlike some AQPs or AQGPs from fungi that have been functionally characterized [21,23,25,36], knowledge of XIP 3D structure, expression and physiological roles is still hypothetical. Thus, a fungal XIP prototype needs to be considered carefully.…”