Are Meningeal Hemangiopericytoma and Mesenchymal Chondrosarcoma the Same?

Fritchie, Karen; Jin, Long; Ruano, Ana Belén García; Oliveira, André M.; Rubin, Brian P.

doi:10.1309/ajcpgungp52zsdns

Cited by 14 publications

(10 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Presently, CNS-based MCS has only been reflected in surgical case reports and small series in the literature [7–15]. Recently, the HEY1 (exon 4)-NCOA2 (exon 13) gene fusion is reported as a recurrent event unique to all MCS [16, 17]. In this study, we report 2 variant gene fusions HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14) in two of our MCS patients.…”

Section: Discussionmentioning

confidence: 99%

Primary paediatric epidural sarcomas: molecular exploration of three cases

et al. 2019

View full text Add to dashboard Cite

Background Primary paediatric epidural sarcomas are extremely rare. Overall, there remains a paucity of knowledge in paediatric epidural sarcomas owing to the infrequent number of cases. The Archer FusionPlex Sarcoma Kit (ArcherDX, Inc) is a next-generation sequencing assay that has been reported to be a useful technique to detect recurrent fusion in sarcomas. We report the molecular exploration of 3 primary paediatric epidural sarcomas—one in the cranium (mesenchymal chondrosarcoma) and 2 in the spine (mesenchymal chondrosarcoma and Ewing sarcoma respectively). Case presentation This is a study approved by the hospital ethics board. Clinico-pathological information from 3 consenting patients with primary epidural sarcomas was collected. These selected tumours are interrogated via Archer FusionPlex Sarcoma Kit (ArcherDX, Inc) for genomic aberrations. Results were validated with RT-PCR and Sanger sequencing. All findings are corroborated and discussed in concordance with current literature. Our findings show 2 variants of the HEY1-NCOA2 gene fusion: HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14), in both mesenchymal chondrosarcoma patients. Next, the Ewing sarcoma tumour is found to have EWSR1 (exon 10)-FLI1 (exon 8) translocation based on NGS. This result is not detected via conventional fluorescence in situ testing. Conclusions This is a molecularly-centered study based on 3 unique primary paediatric epidural sarcomas. Our findings to add to the growing body of literature for these exceptionally rare and malignant neoplasms. The authors advocate global collaborative efforts and in-depth studies for targeted therapy to benefit affected children.

show abstract

Section: Discussionmentioning

confidence: 99%

Primary paediatric epidural sarcomas: molecular exploration of three cases

et al. 2019

View full text Add to dashboard Cite

show abstract

“…13,14) Molecular demonstration of the specific fusion genes, HEY1-NCOA2 and IRF2BP2-CDX1, may thus help or even be required to differentiate these tumors in diagnostically challenging cases. 7,8,12,15,16) In this report, we describe a rare case of intracranial MCS diagnosed by HEY1-NCOA2 gene fusion and highlight the usefulness of molecular assays in surgical samples lacking the typical histopathological features.…”

Section: Introductionmentioning

confidence: 89%

“…The primer sequences used are listed in Table 1. 7,16) A cDNA synthesized from human brain total RNA (Invitrogen, Life Technologies) with a PrimeScript RT Reagent Kit (Takara Bio Inc.) was used as a negative control and the housekeeping gene GAPDH was amplified to check the cDNA quality in both samples, using the primers 16) CGAGATCCTGCAGATGACCGTGG GCACCAGTTGGGCTTTGCAATGTG IRF2BP2-CDX1 7) CAAGAGCCGCGGGTCTGGAGA TGATGTCGTGGGCCATCGGC listed in Table 1. The PCR products were then sequenced using a 3130xl Genetic Analyzer (Applied Biosystems) and a Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), in accordance with the manufacturer's instructions.…”

Section: Molecular Findingsmentioning

confidence: 99%

“…11) Such cases warrant a broad differential diagnosis including meningioma, solitary fibrous tumor/hemangiopericytoma, oligodendroglioma, chordoma, poorly differentiated synovial sarcoma, Ewing sarcoma, lymphoma, small cell osteosarcoma, embryonal rhabdomyosarcoma, and other types of CS. 16,17) Although immunohistochemistry may help make a definitive diagnosis, specific immunohistochemical markers for MCS are currently limited. SOX9 is useful as a specific immunohistochemical marker because MCS can show strong nuclear reactivity for SOX9, indicative of a chondroid lineage.…”

Section: Diagnosis Of Mcs By Histological Analysismentioning

confidence: 99%

See 1 more Smart Citation

Intracranial Mesenchymal Chondrosarcoma Lacking the Typical Histopathological Features Diagnosed by <i>HEY1-NCOA2</i> Gene Fusion

Uneda

Kurozumi

Fujimura

et al. 2020

NMC Case Report Journal

View full text Add to dashboard Cite

“…Recently, two fusion genes were described in mesenchymal CS: the HEY1-NCOA2 fusion and the IRF2BP2-CDX1 fusion [38,39] . Because of the overlapping morphological features in meningeal hemangiopericytoma and mesenchymal CS, identification of the HEY1-NCOA2 fusion, which is not present in meningeal hemangiopericytoma, is inevitable for the diagnosis of mesenchymal CS [40] .…”

Section: Small Round Cell Tumorsmentioning

confidence: 99%

Role of Next-Generation Sequencing as a Diagnostic Tool for the Evaluation of Bone and Soft-Tissue Tumors

2017

View full text Add to dashboard Cite

Bone and soft-tissue tumors are in general rare. Diagnosing these tumors is challenging based on the significant number of different tumor entities, the rareness of these tumors, and the considerable morphological heterogeneity which can be found within a single tumor entity. Considering that more than half of the described soft-tissue tumors and approximately 25% of the bone tumors harbor recurrent genetic alterations, the use of auxiliary molecular examinations should be strongly considered. Molecular analyses are important to confirm the diagnosis, to guide treatment, to provide information about prognosis, and to allow patient recruitment for basket trials based on the molecular signature of a tumor. In addition, novel molecular alterations detected by next-generation sequencing (NGS) obtain further insights into the pathogenesis of these rare tumors and allow a more detailed genetic classification. Based on our single-center results of NGS using the Ion AmpliSeq Cancer Hotspot Panel v2 and the Ion AmpliSeq Comprehensive Cancer Panel (Thermo Fisher Scientific) for mutational analyses as well as the Archer FusionPlex Sarcoma Kit (ArcherDX, Inc) to detect gene fusions in 26 genes since early 2016, we have experienced NGS as a very sensitive method to detect genetic alterations. In our experience, the use of the Archer FusionPlex Sarcoma Kit is superior to fluorescent in situ hybridization as an auxiliary tool in the routine workup of soft-tissue and bone tumors.

show abstract

Are Meningeal Hemangiopericytoma and Mesenchymal Chondrosarcoma the Same?

Abstract: These results show that (1) meningeal HPC and mesenchymal chondrosarcoma are distinct at the molecular level, and (2) the identification of HEY1-NCOA2 can be used as an auxiliary diagnostic tool to differentiate these entities.

Cited by 14 publications

References 14 publications

Primary paediatric epidural sarcomas: molecular exploration of three cases

Primary paediatric epidural sarcomas: molecular exploration of three cases

Intracranial Mesenchymal Chondrosarcoma Lacking the Typical Histopathological Features Diagnosed by <i>HEY1-NCOA2</i> Gene Fusion

Role of Next-Generation Sequencing as a Diagnostic Tool for the Evaluation of Bone and Soft-Tissue Tumors

Contact Info

Product

Resources

About