Are Pericentric Inversions Reorganizing Wedge Shell Genomes?

Abstract

Wedge shells belonging to the Donacidae family are the dominant bivalves in exposed beaches in almost all areas of the world. Typically, two or more sympatric species of wedge shells differentially occupy intertidal, sublittoral, and offshore coastal waters in any given locality. A molecular cytogenetic analysis of two sympatric and closely related wedge shell species, Donax trunculus and Donax vittatus, was performed. Results showed that the karyotypes of these two species were both strikingly different and closely alike; whilst metacentric and submetacentric chromosome pairs were the main components of the karyotype of D. trunculus, 10–11 of the 19 chromosome pairs were telocentric in D. vittatus, most likely as a result of different pericentric inversions. GC-rich heterochromatic bands were present in both species. Furthermore, they showed coincidental 45S ribosomal RNA (rRNA), 5S rRNA and H3 histone gene clusters at conserved chromosomal locations, although D. trunculus had an additional 45S rDNA cluster. Intraspecific pericentric inversions were also detected in both D. trunculus and D. vittatus. The close genetic similarity of these two species together with the high degree of conservation of the 45S rRNA, 5S rRNA and H3 histone gene clusters, and GC-rich heterochromatic bands indicate that pericentric inversions contribute to the karyotype divergence in wedge shells.

Sequence characterization of the 5S ribosomal DNA and the internal transcribed spacer (ITS) region in four European Donax species (Bivalvia: Donacidae)

“…The phylogenetic analyses inferred from 5S rDNA sequences provides a similar tree to that based on the 13 protein-coding genes of mitochondrial genome of the same species [ 20 ], the phylogeny based on several mitochondrial (16S, COI and Cytb) and nuclear (18S, 28S and H3) genes [ 21 ], and the phylogenetic tree derived from the mitochondrial COI gene [ 30 ]. This is in accordance with other bivalve studies where phylogenies have been successfully reconstructed by using the 5S region (e.g.…”

“…[ 55 , 101 ]). On the other hand, ITS phylogeny displays a different topology, but in all cases D. semistriatus and D. vittatus species are grouped in the same clade when markers of different nature are used [ 20 , 21 , 30 ]. In a previous study carried out by Chow et al [ 5 ] who studied the ITS1 in several marine animals was reported that ITS1 has a limited utility for phylogenetic analysis.…”

“…To date, with respect to the Donax genus, the complete female mitochondrial genomes have been sequenced and characterized [ 20 ] and three methods for the molecular identification of European Donax species have been developed [ 22 , 65 , 72 ]. Concerning D. vittatus , a work that deals with the description and study of the karyotype of D. vittatus and compares it with the karyotype of D. trunculus has recently been published [ 30 ] and its genetic diversity and population structure have been evaluated with mitochondrial and nuclear markers [ 21 ]. Regarding D. trunculus , most of the works have focused on studying the karyotype of the species [ 8 , 34 , 58 ], as well as on the analysis of mobile elements and satellite DNA [ 74 , 75 , 78 – 80 , 87 ].…”

Cytogenetics in Arctica islandica (Bivalvia, Arctidae): the Longest Lived Non-Colonial Metazoan

“…DNA was extracted from adductor muscle tissue with the EZNA Mollusc DNA Kit (Omega Bio-Tek, Norcross, USA) following manufacturer indications. DNA sequences were amplified in a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, USA) [ 20 , 23 ]. The pair of newly designed primers AIS-COIF: 5′TTGAGCAGGATTAATAGGAACT3′ and AIS-COIR: 5′AAATGAACAAATAACACAGGATCT3′ was used to amplify a 630 bp long fragment corresponding to the mitochondrial cytochrome c oxidase subunit I (COI) gene.…”

“…Molecular cytogenetic analyses have been published for a total of 32 species of eight families of heterodont bivalves, Cardiidae [ 16 ], Donacidae [ 17 , 18 , 19 , 20 ], Mactridae [ 21 , 22 , 23 , 24 ], Pharidae [ 25 , 26 ], Psammobidae [ 27 ], Veneridae [ 21 , 28 , 29 , 30 , 31 , 32 , 33 , 34 ], Solenidae [ 35 ] and Tellinidae [ 27 , 36 ]. Whilst in all of them diploid chromosome numbers were 2n = 38 and vertebrate type hexamere repeats (TTAGGG)n appeared just at telomeric locations, 45S rDNA, 5S rDNAs and H3 histone gene clusters showed differences in their distribution.…”