Are retroviruses involved in the aetiology of human breast cancer?

Hughes, Gwen; McKerr, George; Allen, J. M.; Barnett, Yvonne

doi:10.1016/0304-3835(96)04217-6

Cited by 1 publication

(2 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This segment has been reported by Dus Santos et al, who proved to be a useful segment in terms of sensitivity and specificity for this type of study. Moreover, this segment is used in export processes to determine and certify VLB free bovine semen [17] The 380 bp fragment was amplified using a PCR Invitrogen  kit and a pair of primers synthesized by Invitrogen  (19327211), Primer Forward (PF; 1068-1088 AAC ACTACGACTTGCAATCC) and Primer Reverse (PR; 1434-1453 GGTTCCTTAGGACTCCGTCG), obtained from standardized protocol for detection of BLV in bull semen samples. PCR conditions were the same as previously reported [17].…”

Section: Blv Gag Gene Fragment Amplification Isolated From Breast Tissuementioning

confidence: 99%

“…In 1995, Wang et al, reported the presence of MMLV segments in cases of breast cancer, after this, Hughes and coworkers proposed again this relation, despite having not found the virus by electronic microscopy but having detected the reverse transcriptase activity in some of the probed samples [17]. In 2002, Melana in Argentina reported gene segments of the same virus (MMLV) in 38% of breast cancer samples evaluated as well as in some cases in leukocytes [14].…”

Section: Phylogenetic Analysismentioning

confidence: 99%

See 1 more Smart Citation

Bovine Leukemia Virus Gene Segment Detected in Human Breast Tissue

Giovanna¹,

Carlos²,

María³

et al. 2013

OJMM

View full text Add to dashboard Cite

Background: Bovine Leukemia Virus (BLV) is known by infections in bovine cattle and produce, in 30% of infected animals, persistent lymphocytosis significantly impacts the beef industry. It has been proposed that this virus could be transmitted to humans and be present in cases of breast cancer. Aim: to determine the presence of 380 bp of gag gene segment of BLV in paraffin-embedded breast tissue. Study Design: Control-case study. Methodology: 106 tissue samples were collected. 53 were cancer positive samples and 53 were negative samples for this pathology. After dewaxing tissues, DNA was extracted, amplified and sequenced. Phylogenetic analysis was done in order to verify BLV gene segment, presence and origin. Results: 43 samples were positive (40.5%) for BLV segment. In the case group this segment was found in 35.8% of the samples and in the control group, BLV presented in 45.2% of the samples. Phylogenetic analysis confirmed BLV presence and had shown a high homology between amplified gene sequences obtained from human breast tissues and those coming from bovine cattle with leukosis reported by GenBank. Conclusion: The presence of BLV genes in humans and its location in breast tissue can be confirmed, however, it should be clarified as a possible promoter of malignancy processes on this tissue.

show abstract

Section: Blv Gag Gene Fragment Amplification Isolated From Breast Tissuementioning

confidence: 99%

Section: Phylogenetic Analysismentioning

confidence: 99%