Aromatase is expressed and active in the rainbow trout oocyte during final oocyte maturation

Abstract

While it is generally well accepted that the ovarian follicular sites of estradiol-17β (E2) synthesis are restricted to somatic cells, the possible contribution of the germinal compartment has received little or no attention in teleosts. In order to demonstrate the expression of ovarian aromatase in the oocyte, cyp19a1a mRNA was studied in ovarian follicles by in situ hybridization. In addition, the expression of cyp19a1a was studied in both somatic and germinal compartments of the ovarian follicle in rainbow trout (Oncorhynchus mykiss) during final oocyte maturation (i.e., maturational competence acquisition and subsequent meiosis resumption) by real-time PCR. The enzymatic activity of ovarian aromatase was also studied in both somatic and germinal compartments of the ovarian follicle. Finally, E2 levels were monitored in follicle-enclosed oocytes throughout the pre-ovulatory period. We were able to demonstrate a significant ovarian aromatase expression and activity in the late vitellogenic oocyte. Furthermore, a dramatic decrease in aromatase expression and activity occurs in the oocyte during late oogenesis, concomitantly with the trend observed in surrounding follicular layers. We also report an unexpected increase of E2 levels in the oocyte during the pre-ovulatory period. To our knowledge, these observations are reported for the first time in any teleost species. Together, our data support the hypothesis of the participation of the germinal compartment in follicular estrogen synthesis and a biological role of E2 during oocyte and/or early embryo development.

Aromatase expression in Xenopus oocytes: a three cell-type model for the ovarian estradiol synthesis

“…Therefore, the contribution of the oocyte compartment to the overall follicular aromatase activity appears more important than initially believed. So far, aromatase expression in the oocyte of non-mammalian vertebrates was never clearly reported or discussed, even though a thorough analysis of existing literature revealed a positive protein signal in the oocyte of medaka (Park et al 2008) and Rana rugosa (Kato et al 2004), and we recently evidenced such an oocyte expression of cyp19a1a in rainbow trout (Gohin et al 2011). In order to further investigate whether oocyte contribution to E 2 synthesis is specific to a few vitellogenic species or, in contrast, a mechanism shared by evolutionary distant vertebrates, it would be interesting to perform such studies in other non-mammalian species.…”

“…2, middle panel), as star has been described as expressed exclusively by the follicular cells in another non-mammalian vertebrate, the rainbow trout (Kusakabe et al 2002, Gohin et al 2011. Although star expression reached a very high level in Xenopus, no oocyte expression was detected significantly above background level (amplification from RT products without reverse transcriptase).…”

“…P450-arom sense and antisense probes were synthesized from Xenopus cDNA clone (BC079750.1) using Riboprobe Combination System (Promega). PCR products were generated using M13 reverse and forward primers (CCCAGTCACGACGTT-GTAAAACGA/AGCGGATAACAATTTCACACAGGA) and were incubated (300 ng) for 2 h at 37 8C with sense (SP6) or antisense (T7) primers in transcription buffer as described previously (Gohin et al 2011). Probe concentration and quality were assessed using nanodrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE, USA).…”

Genetics of Sexual Development: An Evolutionary Playground for Fish

“…Data: Oreochromis niloticus Ijiri et al 2008;Baroiller et al 2009a;Poonlaphdecha et al 2011Poonlaphdecha et al , 2013Tao et al 2013; http://www.uniprot.org/uniprot/ E9RGV7), Oryzias latipes Klüver et al 2005;Nakamoto et al 2007;Shibata et al 2010;Siegfried 2010;Okubo et al 2011;Nakamura et al 2012), Odontesthes hatcheri (Hattori et al 2013), Oncorhynchus mykiss (Baron et al 2005;Sawatari et al 2007;Gohin et al 2011;Vizziano-Cantonnet et al 2011), D. rerio (Chiang et al 2001;Guo et al 2005;Von Hofsten and Olsson 2005;Kallivretaki et al 2007;Siegfried 2010;Gautier et al 2011b;Nakamura et al 2012), Astatotilapia burtoni (Böhne et al 2013;A. Böhne and W. Salzburger, unpublished results).…”

Cytoplasmic Localization of Lrh-1 Down-Regulates Ovarian Follicular cyp19a1a Expression in a Teleost, the Orange-Spotted Grouper Epinephelus coioides1

“…As in zebrafish [9] and rainbow trout [34], the expression levels of Cyp19a1a in the follicular cells were decreased significantly in the ovary of the orange-spotted grouper after vitellogenesis. Quite surprisingly, immunoreactive levels of Lrh-1 instead remained unchanged.…”