Arrangement and number of clustered regularly interspaced short palindromic repeat spacers are associated with erythromycin susceptibility in emm12, emm75 and emm 92 of group A streptococcus

Zheng, Po Xing; Chiang-Ni, Chuan; Wang, S.-Y.; Tsai, Pei Jane; Kuo, Chih Feng; Chuang, Woei Jer; Lin, Yee Shin; Liu, C.-C.; Wu, Jiunn Jong

doi:10.1111/1469-0691.12379

Cited by 10 publications

(14 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Several studies have identified CRISPR-Cas systems in K. pneumoniae chromosomes as I-E and I-E * types (Ostria-Hernandez et al, 2015;Shen et al, 2017;Li et al, 2018) but little is known about CRISPR-Cas systems of plasmids in K. pneumoniae and other Enterobacteriaceae (Enas Newire et al, 2019). CRISPR-Cas systems are associated with relative antibiotic susceptibility in Streptococcus pyogenes and E. coli and the chromosomal CRISPR-Cas system is known to interfere with acquisition of antibioticresistant plasmids in E. coli (Zheng et al, 2014;Aydin et al, 2017). In this study, we examined 699 complete plasmid sequences from K. pneumoniae and 217 K. pneumoniae chromosomal sequences from the GenBank for the presence of CRISPR-Cas system and further analyzed the identified CRISPR-Cas systems and their spacers.…”

Section: Introductionmentioning

confidence: 99%

CRISPR-Cas System in Antibiotic Resistance Plasmids in Klebsiella pneumoniae

Kamruzzaman

Iredell

2020

Front. Microbiol.

View full text Add to dashboard Cite

CRISPR-Cas (clustered regularly interspersed short palindromic repeats-CRISPRassociated protein) is a microbial adaptive immune system involved in defense against different types of mobile genetic elements. CRISPR-Cas systems are usually found in bacterial and archaeal chromosomes but have also been reported in bacteriophage genomes and in a few mega-plasmids. Klebsiella pneumoniae is an important member of the Enterobacteriaceae with which they share a huge pool of antibiotic resistance genes, mostly via plasmids. CRISPR-Cas systems have been identified in K. pneumoniae chromosomes, but relatively little is known of CRISPR-Cas in the plasmids resident in this species. In this study, we searched for CRISPR-Cas system in 699 complete plasmid sequences (>50-kb) and 217 complete chromosomal sequences of K. pneumoniae from GenBank and analyzed the CRISPR-Cas systems and CRISPR spacers found in plasmids and chromosomes. We found a putative CRISPR-Cas system in the 44 plasmids from Klebsiella species and GenBank search also identified the identical system in three plasmids from other Enterobacteriaceae, with CRISPR spacers targeting different plasmid and chromosome sequences. 45 of 47 plasmids with putative type IV CRISPR had IncFIB replicon and 36 of them had an additional IncHI1B replicon. All plasmids except two are very large (>200 kb) and half of them carried multiple antibiotic resistance genes including bla CTX−M , bla NDM , bla OXA. To our knowledge, this is the first report of multi drug resistance plasmids from Enterobacteriaceae with their own CRISPR-Cas system and it is possible that the plasmid type IV CRISPR may depend on the chromosomal type I-E CRISPRs for their competence. Both chromosomal and plasmid CRISPRs target a large variety of plasmids from this species, further suggesting key roles in the epidemiology of large plasmids.

show abstract

Section: Introductionmentioning

confidence: 99%

CRISPR-Cas System in Antibiotic Resistance Plasmids in Klebsiella pneumoniae

Kamruzzaman

Iredell

2020

Front. Microbiol.

View full text Add to dashboard Cite

show abstract

“…A total of 151 GAS isolates, including strain A20 (with a complete genome sequence) [ 15 ], were collected from National Cheng Kung University Hospital in southern Taiwan during 1994–2008 ( S1 Table ). Strain characterization, including identification, PFGE, and emm typing, was described in previous work [ 14 ]. A total of 170 non-redundant GAS strains with incomplete genome sequences and 11 strains with complete genome sequences were obtained from GenBank in the National Center for Biotechnology Information.…”

Section: Methodsmentioning

confidence: 99%

“…The spacer contents of CRISPR01 and CRISPR02 were determined as described [ 14 ]. Briefly, CRISPR01 was amplified with primer CRISPR1-3 (cggtacaattcttgtgctcgaa) and CRISPR1-4 (tcaatggcgtttaacttgatgg) and sequenced with CRISPR1-1 (tgagaaacccgaagtgaa).…”

Section: Methodsmentioning

confidence: 99%

“…The spacer and repeat sequences were determined with the CRISPRtionary tool and CRISPR finder tool [ 16 ]. The presence of cas cassettes was determined by polymerase chain reaction in a previous study [ 14 ].…”

Section: Methodsmentioning

confidence: 99%

“…Experimental data demonstrate that the CRISPR01 locus of GAS strain SF370 can digest the invading nucleic acid, whereas the function of the CRISPR02 locus remains unclear [ 13 ]. The spacer contents and number of spacers are also associated with erythromycin susceptibility in emm 12, emm 75, and emm 92 strains [ 14 ]. The aim of this study was to analyze the association between CRISPR and emm types in GAS, and we found that the emm type and spacer content of two CRISPR loci were associated.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci

et al. 2015

View full text Add to dashboard Cite

Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson’s index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type.

show abstract