Artemisinin protects mice against burn sepsis through inhibiting NLRP3 inflammasome activation

Long, Huibao; Xu, Bincan; Luo, Yun; Luo, Keqin

doi:10.1016/j.ajem.2015.12.075

Cited by 31 publications

(16 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…NLRP3 activation is linked to a number of inflammatory conditions, including sepsis (Long et al. ); and inhibition of NLRP3 is protective against sepsis‐induced lung injury (Luo et al. ) and shock (Mao et al.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

NLRP3 inflammasome activation in platelets in response to sepsis

et al. 2019

View full text Add to dashboard Cite

Sepsis is a complex syndrome characterized by organ dysfunction and a dysregulated immune host response to infection. There is currently no effective treatment for sepsis, but platelets have been proposed as a potential therapeutic target for the treatment of sepsis. We hypothesized that the NLRP 3 inflammasome is activated in platelets during sepsis and may be associated with multiorgan injury in response to polymicrobial sepsis. Polymicrobial sepsis was induced by cecal ligation and puncture ( CLP ) in 12‐ to 13‐week‐old male Sprague–Dawley rats. The necrotic cecum was removed at 24 h post‐ CLP . At 72 h post‐ CLP , activated platelets were significantly increased in CLP versus Sham rats. Colocalization of NLRP 3 inflammasome components was observed in platelets from CLP rats at 72 h post‐ CLP . Plasma, pulmonary, and renal levels of IL ‐1 β and IL ‐18 were significantly higher in CLP rats compared to Sham controls. Soluble markers of endothelial permeability were increased in CLP versus Sham. Renal and pulmonary histopathology were markedly elevated in CLP rats compared to Sham controls. NLRP 3 is activated in platelets in response to CLP and is associated with inflammation, endothelial permeability and multiorgan injury. Our results indicate that activated platelets may play a role to cause multiorgan injury in sepsis and may have therapeutic potential for the treatment of sepsis multiorgan injury.

show abstract

Section: Discussionmentioning

confidence: 99%

“…NLRP3 activation is linked to a number of inflammatory conditions, including sepsis (Long et al. ). Only two other studies have shown NLRP3 activation in platelets (Hottz et al.…”

Section: Discussionmentioning

confidence: 99%

NLRP3 inflammasome activation in platelets in response to sepsis

et al. 2019

View full text Add to dashboard Cite

show abstract

“…The activation of NLRP3 inflammasome has been suggested to play important roles in sepsis ( Gong et al, 2015 ; Kim et al, 2016 ; Long et al, 2016 ; Hao et al, 2017 ; Lee et al, 2017 ), which is currently defined as life threatening organ dysfunction caused by a dysregulated host response to infection ( Singer et al, 2016 ). In the early stages of sepsis, large amounts of proinflammatory cytokines including IL-1β, known as ‘cytokine storm,’ are produced leading to multiple organ injury and failure ( van der Poll et al, 2017 ).…”

Section: Discussionmentioning

confidence: 99%

Scutellarin Suppresses NLRP3 Inflammasome Activation in Macrophages and Protects Mice against Bacterial Sepsis

et al. 2018

View full text Add to dashboard Cite

The NLRP3 inflammasome plays a critical role in mediating the innate immune defense against pathogenic infections, but aberrant activation of NLRP3 inflammasome has been linked to a variety of inflammatory diseases. Thus targeting the NLRP3 inflammasome represents a promising therapeutic for the treatment of such diseases. Scutellarin is a flavonoid isolated from Erigeron breviscapus (Vant.) Hand.-Mazz. and has been reported to exhibit potent anti-inflammatory activities, but the underlying mechanism is only partly understood. In this study, we aimed to investigate whether scutellarin could affect the activation of NLRP3 inflammasome in macrophages. The results showed that scutellarin dose-dependently reduced caspase-1 activation and decreased mature interleukin-1β (IL-1β) release in lipopolysaccharide (LPS)-primed macrophages upon ATP or nigericin stimulation, indicating that scutellarin inhibited NLRP3 inflammasome activation in macrophages. Consistent with this, scutellarin also suppressed pyroptotic cell death in LPS-primed macrophages treated with ATP or nigericin. ATP or nigericin-induced ASC speck formation and its oligomerization were blocked by scutellarin pre-treatment. Intriguingly, scutellarin augmented PKA-specific phosphorylation of NLRP3 in LPS-primed macrophages, which was completely blocked by selective PKA inhibitor H89, suggesting that PKA signaling had been involved in the action of scutellarin to suppress NLRP3 inflammasome activation. Supporting this, the inhibitory effect of scutellarin on NLRP3 inflammasome activation was completely counteracted by H89 or adenyl cyclase inhibitor MDL12330A. As NLRP3-dependent release of IL-1β has a critical role in sepsis, the in vivo activity of scutellarin was assayed in a mouse model of bacterial sepsis, which was established by intraperitoneally injection of a lethal dose of viable Escherichia coli. Oral administration of scutellarin significantly improved the survival of mice with bacterial sepsis. In line with this, scutellarin treatment significantly reduced serum IL-1β levels and attenuated the infiltration of inflammatory cells in the liver of E. coli-infected mice. These data indicated that scutellarin suppressed NLRP3 inflammasome activation in macrophages by augmenting PKA signaling, highlighting its potential therapeutic application for treating NLRP3-related inflammatory diseases.

show abstract

“…To quantitatively determine gene expression, real‐time PCR analysis was performed using QuantiTect SYBR Green PCR 9 Master Mix and the ABI 7300 Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instruction, and the housekeeping gene β‐actin was used as an internal control. Primers for this experiment were as follows : GRP78, forward 5‐GTTTGC TGAGGA AGACAAAAAGCTC‐3, reverse 5‐CACTTCCATAGAGTTTGCTGATAATTG‐3; CHOP, forward 5‐GGAG CTGGAAGCCTGGTATGAGG‐3, reverse 5‐TCCCTGGTCAGGCGCTCGATTTCC‐3; NLRP3, forward ATGGCTGTGTGGATCTTTGC, reverse CACGTGTCATTCCACTCTGG; IL‐1β, forward 5‐CTTCAGGCAGGCAGTATC‐3, reverse 5‐CAGCAGGTTATCATCATCATC‐3; β‐actin (housekeeping gene) forward 5‐GTCAGAAGGACTCCTATGTG‐3 and reverse 5‐ACGCAGCTCATTGTAGAAG‐3. Gene expression was quantified using the relative standard curve method.…”

Section: Methodsmentioning

confidence: 99%

Tauroursodeoxycholic acid produces antidepressant‐like effects in a chronic unpredictable stress model of depression via attenuation of neuroinflammation, oxido‐nitrosative stress, and endoplasmic reticulum stress

Yang

Zhang

et al. 2018

Fundamemntal Clinical Pharma

View full text Add to dashboard Cite

Depression is a common psychiatric disorder with heavy economic and social burdens. Searching new agents with better antidepressant-like activities is of great significance for depression therapy. Tauroursodeoxycholic acid (TUDCA), a clinical drug for gallstone treatment, possesses neuroprotective effects in different brain disorders. However, whether it affects depression remains unclear. We addressed this issue by evaluating the effect of TUDCA on depression induced by chronic unpredictable stress (CUS). Results showed that TUDCA treatment at 200 but not 100 mg/kg prevented the 5 weeks of CUS-induced increases in the immobile time of C57BL6/J mice in the experiments of forced swimming test and tail suspension test as well as the CUS-induced decrease in sucrose intake and crossing numbers in the open-field test, and did not enhance the antidepressant-like effect of fluoxetine. Attenuation of neuroinflammation may be involved in the antidepressant-like effect of TUDCA, as TUDCA treatment (200 mg/kg) normalized the levels of tumor necrosis factor-α and interleukin-6 in both hippocampus and prefrontal cortex. The increases in inflammasome and microglial activation markers, including interleukin-β, nod-like receptor protein 3, and Iba-1, in CUS-treated mice were reduced by TUDCA treatment (200 mg/kg). TUDCA treatment (200 mg/kg) also normalized the changes in markers reflecting the oxidative-nitrosative and endoplasmic reticulum (ER) stress induced by CUS, such as nitric oxide, reduced glutathione, malondialdehyde, glucose-regulated protein 78, and C/EBP homologous protein. These results revealed that TUDCA improved the CUS-induced depression-like behaviors likely through attenuation of neuroinflammation, oxido-nitrosative, and ER stress.

show abstract

Artemisinin protects mice against burn sepsis through inhibiting NLRP3 inflammasome activation

Cited by 31 publications

References 27 publications

NLRP3 inflammasome activation in platelets in response to sepsis

NLRP3 inflammasome activation in platelets in response to sepsis

Scutellarin Suppresses NLRP3 Inflammasome Activation in Macrophages and Protects Mice against Bacterial Sepsis

Tauroursodeoxycholic acid produces antidepressant‐like effects in a chronic unpredictable stress model of depression via attenuation of neuroinflammation, oxido‐nitrosative stress, and endoplasmic reticulum stress

Contact Info

Product

Resources

About