Assessing the effect of phosphate and silicate on Cd bioavailability in soil using an Escherichia coli cadAp::luc-based whole-cell sensor

Abstract

An Escherichia coli cadAp::luc-based whole-cell sensor was constructed to measure cadmium (Cd) bioavailability and assess the immobilizing efficiency of phosphate and silicate on Cd. In previous induction experiments, a linear response (R 2 ¼ 0.97, P < 0.01) from 0.1 to 5 mmol L À1 of Cd was detected by this sensor after a 2 h incubation. , respectively. In other words, SS had 25.68%, 19.5%, and 9.54% better immobilizing efficiency, respectively, compared with DKP. All the results supported SS was more efficient than DKP at immobilizing Cd in soil, and higher soil pH and higher solubility of the immobilizing agents may have been the major factor affecting immobilizing efficiency. In addition, the total and bioavailable Cd in soilwater extracts was only 16.13-35.41% of the sensor contact assay-determined Cd (BSWS), which indicated that the whole-cell sensor-based contact assay was more practical in assessing the risk of Cd in soil after immobilization since it would not overrate the immobilizing capacity of the agents. Environmental impactEnvironmental contamination by cadmium (Cd) is a world-wide problem. Dipotassium phosphate (DKP, K 2 HPO 4 ) and sodium silicate (SS, Na 2 SiO 3 $9H 2 O) are effective and traditional immobilizing agents for metals in soil due to their effectiveness to reduce the mobility of metals. However, a direct comparison of their immobilizing efficiencies for Cd in soil has not been carried out before, more importantly, the mobility of metals did not represent their actual bioavailability and toxicity. Therefore an Escherichia coli-based whole cell sensor for detecting the bioavailability of Cd was constructed, and the immobilizing efficiency of DKP and SS for Cd in soil was then compared with this whole-cell sensor.

The impacts of different long-term fertilization regimes on the bioavailability of arsenic in soil: integrating chemical approach with Escherichia coli arsRp::luc-based biosensor

“…The plasmid parsRluc of the E. coli arsRp::luc-based biosensor was developed from the elementary plasmid frame pUC18luc, which can efficiently express the luminescence reporter gene luc of commercial plasmid pGEM-luc (Promega, USA; GenBank accession number X65316) at the T7 promoter (Hou et al 2013). For the construction of parsRluc, a cloned fragment containing the regulatory gene arsR (GenBank accession number NC_000913) and its promoter Pars was amplified (forward primer 5′GATCGAGCTC TTACCTTCCTCTGCACTTAC3′; reverse primer: 5′CCGC TCGAGTTAACTGCAAATGTTCTTACTGTCCCC3′) from the As resistance system of plasmid R773 of E. coli K-12 (Biomed, China).…”

Detection of bioavailable cadmium, lead, and arsenic in polluted soil by tailored multiple Escherichia coli whole-cell sensor set

“…S1a) and pcadCluc (ESM Fig. S1b) sensors were constructed in the previous research by our laboratory [8,9]. The pzntRluc sensor (ESM Fig.…”

“…The pzntRluc sensor (ESM Fig. S1c) was constructed by this study as follows: The Pznt promoter was amplified using the primers Pznt-F/Pznt-R and linked to the upstream of luc in pUC18luc [8], which was then digested using SacΙ and XhoΙ. Next, the primers PnptΙΙ-F/PnptΙΙ-R, Pznt-R-F/Pznt-R-R, and PrrNB-F/PrrNB-R were used to construct constitutively expressed zntR (NC_007779) fragment from E. coli DH5α (Biomed, China).…”

“…Specificity analysis of sensors to Cd, Pb, and As Standard induction assays [8] for the pcadCluc, pzntRluc, and parsRluc sensors were performed to determine their specificity to Cd, Pb, and As. Relative luminescence units (RLUs) were measured using the GloMax-Multi microplate multimode reader (Promega, USA).…”