Assessing the viability of transplanted gut microbiota by sequential tagging with D-amino acid-based metabolic probes

Wang, Wei; Lin, Liang; Du, Yahui; Song, Yanling; Peng, Xiaoman; Chen, Xing; Yang, Chaoyong

doi:10.1038/s41467-019-09267-x

Cited by 87 publications

(57 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The C57BL/6 mice were sequentially administered by two different FDAA probes (200 μl, 1 mM TADA or Cy5ADA in distilled H 2 O) through oral gavage with an interval of 3 hours. Their small intestine and cecal microbiotas were collected using a previously reported protocol ( 9 ). Briefly, mice were euthanized by cervical dislocation, and the small intestine and cecum were dissected separately and finely minced with a pair of 11.43-cm iris scissors in 1 ml of phosphate-buffered saline (PBS).…”

Section: Methodsmentioning

confidence: 99%

Revealing the in vivo growth and division patterns of mouse gut bacteria

Lin

Song

et al. 2020

Sci. Adv.

Self Cite

View full text Add to dashboard Cite

Current techniques for studying gut microbiota are unable to answer some important microbiology questions, like how different bacteria grow and divide in the gut. We propose a method that integrates the use of sequential d-amino acid–based in vivo metabolic labeling with fluorescence in situ hybridization (FISH), for characterizing the growth and division patterns of gut bacteria. After sequentially administering two d-amino acid–based probes containing different fluorophores to mice by gavage, the resulting dual-labeled peptidoglycans provide temporal information on cell wall synthesis of gut bacteria. Following taxonomic identification with FISH probes, the growth and division patterns of the corresponding bacterial taxa, including species that cannot be cultured separately in vitro, are revealed. Our method offers a facile yet powerful tool for investigating the in vivo growth dynamics of the bacterial gut microbiota, which will advance our understanding of bacterial cytology and facilitate elucidation of the basic microbiology of this gut “dark matter.”

show abstract

Section: Methodsmentioning

confidence: 99%

Revealing the in vivo growth and division patterns of mouse gut bacteria

Lin

Song

et al. 2020

Sci. Adv.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Extracted DNA samples were sent to Shanghai Personal Biotechnology Co., Ltd. (Shanghai, China) for paired‐end sequencing using the Illumina Miseq platform (Illumina Miseq PE300). The 338F (5′‐ACTCCTACGGGAGGCAGCA‐3′) and 806R (5′‐GGACTACHVGGGTWTCTAAT‐3′) primers were used to amplify the hypervariable region V3‐V4 of the bacterial 16S rRNA gene (Wang et al, 2019). The internal transcribed spacer 1 (ITS1) region of fungi was amplified using the primers ITS5F (5′‐GGAAGTAAAAGTCGTAACAAGG‐3′) and ITS1R (5′‐GCTGCGTTCTTCATCGATGC‐3′) (White, Bruns, Lee, & Taylor, 1990).…”

Section: Methodsmentioning

confidence: 99%

Soil bacterial and fungal communities and associated nutrient cycling in relation to rice cultivation history after reclamation of natural wetland

Huang

et al. 2020

Land Degrad Dev

View full text Add to dashboard Cite

The reclamation and utilization of natural wetlands can affect the community structure of soil microorganisms. However, knowledge regarding succession of microbial communities during long‐term reclamation and the links with related nutrient cycles is still limited. Using Illumina sequencing, we identified the patterns and environmental drivers of soil bacterial and fungal succession along a 150‐year chronosequence of paddy fields. Soil enzyme activities were determined to characterize functions related to C, N, and P cycles. The results showed that reclamation activity and its history have greatly altered the bacterial community structure and the bacterial groups. This change being mainly reflected in the bacterial genera Halomonas, genera Isosphaera, and family Planctomycetaceae. The change of fungal community was mainly apparent between natural wetlands and paddy fields, manifested as an increase in the classes Sordariomycetes and Dothideomycetes and a significant decrease inthe class Agaricomycetes in paddy fields compared with natural wetland. Compared with fungi, bacteria were more strongly affected by soil chemical nutrient properties and physical properties. Furthermore, the structural equation model indicated that both bacterial and fungal community structure and diversity had a great influence on the C, N, and P cycles. In summary, the bacterial community was more sensitive throughout the history of rice cultivation after reclamation than the fungal community, but both bacteria and fungi may play major roles in soil ecological functions. These findings contribute to the understanding of ecosystem functional mechanisms, which provides a new perspective for the management of natural wetlands.

show abstract

“…However, its use in gut microbial imaging has never been explored, which can be partially attributed to the difficulties in efficient fluorescence tagging of microbiotas. To label the gut microbiota with high coverage, efficiency, and cell compatibility, we employed a DAA‐based in vivo metabolic labeling strategy, which we recently developed and integrated it with click reaction (Scheme shown in Figure a) using an azide‐containing NIR‐II dye (IR‐FGN, Figure b). d ‐Alanine is a conserved amino acid at the peptidoglycan (PGN) stem peptide of bacteria, and d ‐amino acid (DAA) with modified side chains, can be tolerated by the enzymes involved in PGN synthesis and used as PGN‐specific metabolic labeling probes.…”

Section: Figurementioning

confidence: 99%

Metabolic Labeling of Peptidoglycan with NIR‐II Dye Enables In Vivo Imaging of Gut Microbiota

Wang

Yang

et al. 2020

Angewandte Chemie

Self Cite

View full text Add to dashboard Cite

Deepening our understanding of mammalian gut microbiota has been greatly hampered by the lack of a facile, real‐time, and in vivo bacterial imaging method. To address this unmet need in microbial visualization, we herein report the development of a second near‐infrared (NIR‐II)‐based method for in vivo imaging of gut bacteria. Using d‐propargylglycine in gavage and then click reaction with an azide‐containing NIR‐II dye, gut microbiota of a donor mouse was strongly labeled with NIR‐II fluorescence on their peptidoglycan. The bacteria could be readily visualized in recipient mouse gut with high spatial resolution and deep tissue penetration under NIR irradiation. The NIR‐II‐based metabolic labeling strategy reported herein, provides, to the best of our knowledge, the first protocol for facile in vivo visualization of gut microbiota within deep tissues, and offers an instrumental tool for deciphering the complex biology of these gut “dark matters”.

show abstract

Assessing the viability of transplanted gut microbiota by sequential tagging with D-amino acid-based metabolic probes

Cited by 87 publications

References 31 publications

Revealing the in vivo growth and division patterns of mouse gut bacteria

Revealing the in vivo growth and division patterns of mouse gut bacteria

Soil bacterial and fungal communities and associated nutrient cycling in relation to rice cultivation history after reclamation of natural wetland

Metabolic Labeling of Peptidoglycan with NIR‐II Dye Enables In Vivo Imaging of Gut Microbiota

Contact Info

Product

Resources

About