Association Between rs1859168/HOTTIP Expression Level and Colorectal Cancer and Adenomatous Polyposis Risk in Egyptians

Abstract

LncRNA HOTTIP is a new lncRNA that is strictly linked to the susceptibility, growth, propagation, and prognosis of several human cancers together with colorectal cancer. lncRNA HOTTIP rs1859168 may confer colorectal cancer susceptibility through regulating its gene expression level. To elucidate its role in colorectal cancer risk, we genotyped rs1859168 A>C and measured serum HOTTIP expression level in colorectal cancer, adenomatous polyposis patients and controls by real-time polymerase chain reaction. The results displayed that rs1859168 A>C single-nucleotide polymorphism is a risk factor for colorectal cancer among adenomatous polyposis patients and controls, AC versus CC genotypes [adjusted odds ratio (OR) = 2.256, 95% confidence interval (CI) = 1.316-3.868, P = 0.003] when compared with controls and (adjusted OR = 9.521, 95% CI = 3.330-27.217, P < 0.0001) when compared with adenomatous polyposis. Serum HOTTIP was upregulated in the colorectal cancer group when compared with adenomatous polyposis or controls [median (interquartile Color images are available online.

The Influence of rs1859168 Polymorphism on Serum Expression of HOTTIP and Its Target miR-615-3p in Egyptian Patients with Breast Cancer

“…Gong et al revealed that individuals who carry the AA genotype might be at a decreased risk for lung cancer [ 25 ]. Additionally, Ali et al demonstrated a significant association between rs1859168 polymorphism (CC genotype and C allele) and susceptibility to colorectal cancer in the Egyptian population, which is similar to our results [ 26 ].…”

Serum lncRNAs, NBAT‐1, and FOXCUT signature in hepatocellular carcinoma developed on top of chronic hepatitis C

“…Respects FOXCUT , our results agreed with Wang et al 20 and Fang et al 21 who reported downregulated FOXCUT in choroidal malignant melanoma (CMM) cell lines and neck squamous cell carcinoma tissue samples respectively, they reported that lncRNA FOXCUT functions as a tumor suppressor gene that inhibiting cell proliferation, migration, and invasion, and inducing cell cycle arrest and cell apoptosis, also, induction of FOXCUT significantly reduces the matrix metalloproteinases (MMPs) (MMP‐2/MMP‐9) expressions which are endopeptidases mediating the degradation of the extracellular matrix facilitates tumor propagation 20,21 . In opposition, other researchers speculated that FOXCUT is an oncogene and was upregulated in serum collected from patients with gastric adenocarcinoma 19 and tissues specimens obtained from patients with esophageal squamous cell carcinoma, 16 nasopharyngeal carcinoma, 17 oral squamous cell carcinoma 16 and basal‐like breast cancer, 8 they documented that FOXCUT exerts its function by directly influencing its upstream protein‐coding gene FOXC1 which is a member of the Forkhead Box (FOX) family of transcription factors that regulate tumor incidence and propagation 16–18 . Discrepancies may be due to the that lncRNAs are signals that have cell‐type and time‐specific expression patterns throughout the cancer developing process thus, lncRNAs can act as a marker for a particular biological event in a specific tissue 31 …”

“…The primer sequences of GAPDH were as follows: forward 5‐CCCTTCATTGACCTCAACTA‐3, reverse 5‐TGGAAGATGGTGATGGGATT‐3. The $<math altimg="urn:x-wiley:08991987:media:mc23488:mc23488-math-0001" wiley:location="equation/mc23488-math-0001.png" xmlns="http://www.w3.org/1998/Math/MathML"><mrow><mrow><msup><mn>2</mn><mrow><mo>\unicode{x02212}</mo><mi>\unicode{x00394}\unicode{x00394}</mi><msub><mi>C</mi><mi mathvariant="normal">t</mi></msub></mrow></msup></mrow></mrow></math>$ equation was used for the determination of the relative expression (fold change) of lncRNA ( NBAT‐1 and FOXCUT ) in the serum 8 . Many previous studies measured serum lncRNAs, including FOXCUT , in HCC 18,22 …”

“…Also, some models of lncRNAs were documented to be translational and post‐translational regulators 5,6 . Many recent studies have linked the presence of a detectable amount of lncRNAs in circulation to the development and propagation of tumors 7,8 . Among the newly discovered lncRNAs were Neuroblastoma‐associated transcript‐1 ( NBAT‐1 ) 9 and Forehead box C1 promoter upstream transcript ( FOXCUT ) 10 …”

“…5,6 Many recent studies have linked the presence of a detectable amount of lncRNAs in circulation to the development and propagation of tumors. 7,8 Among the newly discovered lncRNAs were Neuroblastomaassociated transcript-1 (NBAT-1) 9 and Forehead box C1 promoter upstream transcript (FOXCUT). 10 NBAT-1, a recently discovered tumor suppressor lncRNA, has paid a lot of consideration.…”