Association of Clinical Features With Mutation of TECTA in a Family With Autosomal Dominant Hearing Loss

Iwasaki, Satoshi; Harada, Daisuke; Usami, Shin‐ichi; Nagura, Mitsuyoshi; Takeshita, Tamotsu; Hoshino, Tomoyuki

doi:10.1001/archotol.128.8.913

Cited by 40 publications

(32 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Among those, the family with the c.6063G4A (p.R2021H) mutation was previously reported by Iwasaki et al 5 Including those results, TECTA mutations were detected in 2.9% (4/139) of Japanese ADNSHL families, and the prevalence in moderate hearing loss was 7.7% (4/52).…”

Section: Resultsmentioning

confidence: 70%

“…Before this study, one Japanese family with 6063G4A (R2021H) mutation had been reported. 5 TECTA mutations in Japanese H Moteki et al that family, prevalence of ADNSHL with TECTA mutation was 2.9% (4/139 families), which may be a relatively high incidence. Hildebrand et al 8 reported that its prevalence was about 4% in Spanish ADNSHL families (17/374 families).…”

Section: Discussionmentioning

confidence: 97%

“…13 The mutatagenesis primers for 5509TG, 5876A4G and 6063G4A, which were previously reported from Spain, 4 Austria 14 and Japan, 5 respectively, were designed. The following reverse primers were used to produce the mutations for initial PCR reaction: 5509TG CCCCTCGATGCCGGTGCCC TGTCTGTCA, 5876AG TCCAGAGTGTGTTTTTACACATGATATG and 6063GA ACCGAGCTGGAAGAACTTGCACTTAGAT.…”

Section: Site-directed Gene Mutagenesismentioning

confidence: 99%

“…[3][4][5][6][7][8][9][10] This gene encodes a-tectorin, the major component of noncollagenous glycoprotein of the tectorial membrane that consists of an extracellular matrix overlying the organ of corti, contacting the outer cochlear hair cells, and having a role in intracochlear sound transmission. 11 The a-tectorin is composed of three distinct modules: the entactin G1 domain, the zonadhesin (ZA) domain with von Willebrand factor type D repeats and the zona pellucida (ZP) domain.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

TECTA mutations in Japanese with mid-frequency hearing loss affected by zona pellucida domain protein secretion

et al. 2012

Self Cite

View full text Add to dashboard Cite

TECTA gene encodes a-tectorin, the major component of noncollagenous glycoprotein of the tectorial membrane, and has a role in intracochlear sound transmission. The TECTA mutations are one of the most frequent causes of autosomal dominant (AD) hearing loss and genotype-phenotype correlations are associated with mutations of TECTA in exons according to a-tectorin domains. In this study, we investigated the prevalence of hearing loss caused by TECTA mutations in Japanese AD hearing loss families, and confirmed genotype-phenotype correlation, as well as the intracellular localization of missense mutations in the a-tectorin domain. TECTA mutations were detected in 2.9% (4/139) of our Japanese AD hearing loss families, with the prevalence in moderate hearing loss being 7.7% (4/52), and all patients showed typical genotype-phenotype correlations as previously described. The present in vitro study showed differences of localization patterns between wild type and mutants, and suggested that each missense mutation may lead to a lack of assembly of secretion, and may reduce the incorporation of a-tectorin into the tectorial membrane.

show abstract

Section: Resultsmentioning

confidence: 70%

Section: Discussionmentioning

confidence: 97%

Section: Site-directed Gene Mutagenesismentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

TECTA mutations in Japanese with mid-frequency hearing loss affected by zona pellucida domain protein secretion

et al. 2012

Self Cite

View full text Add to dashboard Cite

show abstract

“…Missense mutations cause dominant hearing loss, the phenotype of which depends on the domain and residue affected (Verhoeven et al 1998;Alloisio et al 1999;Balciuniene et al 1999;MorenoPelayo et al 2001;Iwasaki et al 2002;Pfister et al 2004;Plantinga et al 2006;Meyer et al 2007a). All recessive mutations known thus far are of a truncating nature (i. e., splice site, frameshift, and nonsense mutations or a large deletion of exon 10) and cause moderate to profound prelingual deafness (Mustapha et al 1999;Naz et al 2003;Meyer et al 2007b;Alasti et al 2008).…”

Section: Introductionmentioning

confidence: 99%

Characterization of a Spontaneous, Recessive, Missense Mutation Arising in the Tecta Gene

Moreno-Pelayo

Goodyear

Mencía

et al. 2008

JARO

View full text Add to dashboard Cite

The TECTA gene encodes alpha-tectorin (TECTA), a major noncollagenous component of the tectorial membrane (TM). In humans, mutations in TECTA lead to either dominant (DFNA8/A12) or recessive (DFNB21) forms of nonsyndromic hearing loss. All missense mutations in TECTA that have been reported thus far are associated with the dominant subtype, whereas those leading to recessive deafness are all inactivating mutations. In this paper, we characterize a spontaneous missense mutation (c.1046C 9A, p.A349D) arising in the mouse Tecta gene that is, unlike all previously reported missense mutations in TECTA, recessive. The morphological phenotype of the Tecta A349D/A349D mouse resembles but is not identical to that previously described for the Tecta ÁENT=ÁENT mouse. As in the Tecta ÁENT=ÁENT mouse, the TM is completely detached from the surface of the organ of Corti and spiral limbus, lacks a striated-sheet matrix, and is deficient in both betatectorin (Tectb) and otogelin. A significant amount of Tecta is, however, detected in the TM of the Tecta A349D/A349D mouse, and numerous, electrondense matrix granules are seen interspersed among the disorganized collagen fibrils. Mutated Tecta A349D is therefore incorporated into the TM but presumably unable to interact with either Tectb or otogelin. The Tecta A349D/A349D mouse reveals that missense mutations in Tecta can be recessive and lead to TM detachment and suggests that should similar mutations arise in the human population, they would likely cause deafness.

show abstract

Identification of three novel TECTA mutations in Iranian families with autosomal recessive nonsyndromic hearing impairment at the DFNB21 locus

Meyer

Alasti

Nishimura

et al. 2007

American J of Med Genetics Pt A

View full text Add to dashboard Cite

Forty-five consanguineous Iranian families segregating autosomal recessive nonsyndromic hearing loss (ARNSHL) and negative for mutations at the DFNB1 locus were screened for allele segregation consistent with homozygosity by descent (HBD) at the DFNB21 locus. In three families demonstrating HBD at this locus, mutation screening of TECTA led to the identification of three novel homozygous mutations: one frameshift mutation (266delT), a transversion of a cytosine to an adenine (5,211C > A) leading to a stop codon, and a 9.6 kb deletion removing exon 10. In total, six mutations in TECTA have now been described in families segregating ARNSHL. All of these mutations are inactivating and produce a similar phenotype that is characterized by moderate-to-severe hearing loss across frequencies with a mid frequency dip. The truncating nature of these mutations is consistent with loss-of-function, and therefore the existing TECTA knockout mouse mutant represents a good model in which to study DFNB21-related deafness.

show abstract

Association of Clinical Features With Mutation of TECTA in a Family With Autosomal Dominant Hearing Loss

Cited by 40 publications

References 13 publications

TECTA mutations in Japanese with mid-frequency hearing loss affected by zona pellucida domain protein secretion

TECTA mutations in Japanese with mid-frequency hearing loss affected by zona pellucida domain protein secretion

Characterization of a Spontaneous, Recessive, Missense Mutation Arising in the Tecta Gene

Identification of three novel TECTA mutations in Iranian families with autosomal recessive nonsyndromic hearing impairment at the DFNB21 locus

Contact Info

Product

Resources

About