Association of genetic variants in the 3′UTR of HLA-G with Recurrent Pregnancy Loss

Amodio, Giada; Canti, Valentina; Maggio, Luana; Rosa, Susanna; Castiglioni, M.; Rovere‐Querini, Patrizia; Gregori, Silvia

doi:10.1016/j.humimm.2016.06.020

Cited by 30 publications

(33 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In agreement, several associations between specific HLA-G 3’UTR haplotypes and pathological situations where HLA-G expression is relevant have been identified. For instance, according to our results, UTR-5 and UTR-7 frequencies are higher in recurrent pregnancy loss [50], whereas UTR-1 has been associated with reduced risk of recurrent pregnancy loss [51]. Besides, 3’UTR variants have been identified as potential prognostic biomarkers to determine susceptibility to infections [52, 53],the success of transplantation [54], and the outcome of cancer [55] and autoimmune diseases [56].…”

Section: Discussionmentioning

confidence: 82%

Haplotypes of the HLA-G 3’ Untranslated Region Respond to Endogenous Factors of HLA-G+ and HLA-G- Cell Lines Differentially

et al. 2017

View full text Add to dashboard Cite

The immune checkpoint HLA-G prevents maternal rejection of the fetus and contributes in cancer invasion and acceptance of allografts. The 5’ and 3’ regulatory regions of the HLA-G gene are polymorphic and balancing selection probably maintains this variability. It is proposed that nucleotide variations may affect the level of HLA-G expression. To investigate this issue we aimed to analyze how haplotypes of the 3’ untranslated region (3’UTR) with highest worldwide frequencies, namely UTR-1, UTR-2, UTR-3, UTR-4, UTR-5, UTR-18 and UTR-7, impact the expression of a luciferase reporter gene in vitro. Experiments performed with the HLA-G positive cell lines JEG-3 (choricarcinoma) and FON (melanoma), and with the HLA-G negative cell lines M8 (melanoma) and U251MG (glioblastoma) showed that the HLA-G 3’UTR polymorphism influences the response to endogenous cellular factors and may vary according to the cell type. UTR-5 and UTR-7 impact the activity of luciferase the most whereas UTR-2, UTR-3, UTR-4, and UTR-18 have intermediate impact, and UTR-1 has the lowest impact. These results corroborate the previous associations between amounts of plasma sHLA-G levels and 3’UTR haplotypes in healthy individuals and reinforce that 3’UTR typing may be a predictor of the genetic predisposition of an individual to express different levels of HLA-G.

show abstract

Section: Discussionmentioning

confidence: 82%

Haplotypes of the HLA-G 3’ Untranslated Region Respond to Endogenous Factors of HLA-G+ and HLA-G- Cell Lines Differentially

et al. 2017

View full text Add to dashboard Cite

show abstract

“…This study has showed a higher frequency of −14 bp allele in RM women (statistically non‐significant) and +14 bp allele in fertile control women. But Amodio et al have reported +14 bp allele more frequent in RM women compared with the control women (50% vs 35%).…”

Section: Discussionmentioning

confidence: 87%

“…Another study has reported that UTR‐3 haplotype (associated with high sHLA‐G levels) was found significantly ( P = .0078) less frequent in RM women compared with control women. Moreover, an association of specific HLA‐G 3′UTR haplotypes was shown with two pregnancy losses and not with three or more pregnancy losses . There are several studies which have reported positive and supportive role played by sHLA‐G in different pathological conditions such as positive pregnancy outcome and organ transplantation.…”

Section: Discussionmentioning

confidence: 96%

TheHLA‐G14 bp insertion/deletion polymorphism and its association with soluble HLA‐G levels in women with recurrent miscarriages

Kalotra

Lall

Verma

et al. 2018

HLA

View full text Add to dashboard Cite

HLA-G, a nonclassical class-Ib gene is mainly expressed on extravillous trophoblasts at the fetal-maternal interface. HLA-G molecule is considered to play an important role in maternal immune suppression during pregnancy. The 14 bp insertion/deletion polymorphism (rs66554220) in exon eight of the HLA-G gene influences HLA-G mRNA stability and isoform splicing patterns. In this study, 202 recurrent miscarriage (RM) women with two or more than two consecutive miscarriages, their 202 partners and 204 fertile control women with at least one live birth and no miscarriages were analyzed for 14 bp insertion/deletion polymorphism. Soluble HLA-G (sHLA-G) levels were also determined and compared between randomly selected 111 RM women and 111 control women using QAYEE-Bio ELISA kits. Student's t test and χ test were used to depict the statistical differences. The results showed no significant differences for 14 bp allele and genotype frequencies between the study groups. However, our study showed a significant difference (P = .0107) for sHLA-G levels in RM women and control women. Furthermore, a significant difference (P = .0135) for sHLA-G levels in relation to +/-14 bp heterozygous genotype was seen between the two groups. The 14 bp allele sharing between the partners did not show any significant association with the number of miscarriages in RM couples. The association of 14 bp polymorphism and recurrent miscarriages was not significant in our study.

show abstract

“…Genomic DNA was extracted from peripheral blood lymphocytes using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). HLA‐G 14‐bp InDel polymorphism was determined by polymerase chain reaction (PCR) as previously described (Amodio et al, ). The sequences of PCR primers were as follows: forward primer: 5′‐GTGATGGGCTGTTTAAAGTGTCACC‐3 and reverse primer: 5′‐GGAAGGAATGCAGTTCAGCATGA‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…HLA-G 14-bp InDel polymorphism was determined by polymerase chain reaction (PCR) as previously described (Amodio et al, 2016).…”

Section: Dna Extraction and Hla-g 14-bp Indel Polymorphism Typingmentioning

confidence: 99%

Human leucocyte antigen‐G 14‐bp InDel polymorphism and oral squamous cell carcinoma risk in Chinese Han population: A case–control study

Wang

Zhao

Liu

et al. 2018

Int J Immunogenetics

View full text Add to dashboard Cite

Human leucocyte antigen-G (HLA-G) is a nonclassical HLA class I molecule involved in tumour immune escape. The purpose of this study was to investigate the association between the 14-bp insertion/deletion (InDel) polymorphism in the 3' untranslated region (3'-UTR) of HLA-G gene and oral squamous cell carcinoma (OSCC) risk in Chinese Han population (216 cases and 193 healthy controls), and furthermore, to evaluate serum soluble HLA-G (sHLA-G) levels in the OSCC patients. Our results demonstrated that the Ins allele was significantly less frequent in the OSCC patients than that in the healthy controls (odds ratio [OR] = 0.75; 95% confidence interval [CI]: 0.57-0.99; p = 0.040). Distribution of the 14-bp genotypes in the OSCC patients and the healthy controls revealed that the Ins/Ins genotype was associated with decreased OSCC risk in both the codominant model (Ins/Ins versus Del/Del; OR = 0.57; 95% CI = 0.33-0.99; p = 0.044) and the log-additive model (OR = 0.76; 95% CI: 0.58-0.99; p = 0.044). The serum sHLA-G level was significantly higher in the OSCC patients than those in the healthy controls (p < 0.001). Receiver operating characteristic (ROC) curve revealed the valuable diagnostic value of sHLA-G for OSCC detection, with an area under the ROC curve (AUC) of 0.891 (95% CI: 0.856-0.925, p < 0.001). The OSCC patients with Ins/Ins genotype had lower serum sHLA-G levels than those with Ins/Del and Del/Del genotypes (p = 0.015). Furthermore, serum sHLA-G levels were significantly increased with the increasing TNM stages of the OSCC patients (p = 0.017). Our findings revealed that the HLA-G 14-bp InDel polymorphism might be a genetic risk factor for OSCC susceptibility, and the serum sHLA-G may act as a promising biomarker for noninvasive diagnosis of OSCC.

show abstract

Association of genetic variants in the 3′UTR of HLA-G with Recurrent Pregnancy Loss

Cited by 30 publications

References 35 publications

Haplotypes of the HLA-G 3’ Untranslated Region Respond to Endogenous Factors of HLA-G+ and HLA-G- Cell Lines Differentially

Haplotypes of the HLA-G 3’ Untranslated Region Respond to Endogenous Factors of HLA-G+ and HLA-G- Cell Lines Differentially

TheHLA‐G14 bp insertion/deletion polymorphism and its association with soluble HLA‐G levels in women with recurrent miscarriages

Human leucocyte antigen‐G 14‐bp InDel polymorphism and oral squamous cell carcinoma risk in Chinese Han population: A case–control study

Contact Info

Product

Resources

About