Association of RIT2 and RAB7L1 with Parkinson's disease: a case-control study in a Taiwanese cohort and a meta-analysis in Asian populations

Liu, Tsai-Wei; Wu, Yih‐Ru; Chen, Yi‐Chun; Fung, Hon Chung; Chen, Chiung‐Mei

doi:10.1016/j.neurobiolaging.2019.11.001

Cited by 6 publications

(3 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The association of RIT2 rs12456492 with PD risk among the Caucasian population has been investigated and found to be significant [ 29 ]. The relevant results in Asian populations in different studies have been inconsistent, but a recent meta-analysis of Asian populations demonstrated that RIT2 rs12456492 may increase PD risk in Asian individuals [ 30 ], while RIT2 rs12456492 was not associated with disease progression in our Chinese PD cohort. In a previous GWAS meta-analysis, a suggestive association of PD motor subtype with RIT2 rs12456492 was detected, implicating disease progression.…”

Section: Discussionmentioning

confidence: 88%

MAO-B Polymorphism Associated with Progression in a Chinese Parkinson’s Disease Cohort but Not in the PPMI Cohort

chen

Wu²,

et al. 2022

Parkinson's Disease

View full text Add to dashboard Cite

Introduction Genetic factors play an important role in Parkinson's disease (PD) risk. However, the genetic contribution to progression in Chinese PD patients has rarely been studied. This study investigated genetic associations with progression based on 30 PD risk loci common in a longitudinal cohort of Chinese PD patients and the Parkinson's Progression Markers Initiative (PPMI) cohort. Methods PD patients from the true world (TW) Chinese PD longitudinal cohort and the PPMI cohort with demographic information and assessment scales were assessed. A panel containing 30 PD risk single nucleotide polymorphisms was tested. Progression rates of each scale were derived from random-effect slope values of mixed-effects regression models. Progression rates of multiple assessments were combined by using principal component analysis (PCA) to derive scores for composite, motor, and nonmotor progression. The association of genetic polymorphism and separate scales or PCA progression was analysed via linear regression. Results In the Chinese PD cohort, MAOB rs1799836 was associated with progression based on the Montreal Cognitive Assessment, the top 3 principal components (PCs) of nonmotor PCA and PC1 of the composite PCA. In the PPMI cohort, both MDS-Unified Parkinson's Disease Rating Scale II and motor PC1 progression were associated with RIT2 rs12456492. The PARK16 haplotype was associated with Geriatric Depression Scale and the State-Trait Anxiety Inventory for Adults progression, and the SNCA haplotype was associated with the Hoehn-Yahr staging progression and motor PC1 progression. Ethnicity-stratified analysis showed that the association between MAOB rs1799836 and PD progression may be specific to Asian or Chinese patients. Conclusion MAOB rs1799836 was associated with the progression of nonmotor symptoms, especially cognitive impairment, and the composite progression of motor and nonmotor symptoms within our Chinese PD cohort. The RIT2 rs12456492 and SNCA haplotypes were associated with motor function decline, and the PARK16 haplotype was associated with progression in mood in the PPMI cohort.

show abstract

Section: Discussionmentioning

confidence: 88%

MAO-B Polymorphism Associated with Progression in a Chinese Parkinson’s Disease Cohort but Not in the PPMI Cohort

chen

Wu²,

et al. 2022

Parkinson's Disease

View full text Add to dashboard Cite

show abstract

“…Parts of the results of the top 20 risk SNPs for PD analyzed by using iPLEX methodology as described above have been published previously [ 13 , 14 , 15 , 16 ]. A total of 586 patients with PD and 586 healthy controls (HCs) were included for analysis of FGF20 and rs591323 in this study.…”

Section: Resultsmentioning

confidence: 99%

Fibroblast Growth Factor 20 Gene Polymorphism in Parkinson’s Disease in Asian Population: A Meta-Analysis

Chiang

Chen

et al. 2021

Genes

Self Cite

View full text Add to dashboard Cite

Parkinson’s disease (PD) is a neurodegenerative disease with the pathological hallmark of Lewy bodies and Lewy neurites composed of α-synuclein. The SNP rs591323 is one of the risk loci located near the FGF20 gene that has been implicated in PD. The variation of FGF20 in the 3′ untranslated region was shown to increase α-synuclein expression. We examined the association of rs591323 with the risk of PD in a Taiwanese population and conducted a meta-analysis, including our study and two other studies from China, to further confirm the role of this SNP in Taiwanese/Chinese populations. A total of 586 patients with PD and 586 health controls (HCs) were included in our study. We found that the minor allele (A) and the AA + GA genotype under the dominant model are significantly less frequent in PD than in controls. The meta-analysis consisted of 1950 patients with PD and 2073 healthy controls from three studies. There was significant association between rs591323 and the risk of PD in the additive (Z = −3.96; p < 0.0001) and the dominant models (Z = −4.01; p < 0.0001). Our study results and the meta-analysis support the possible protective role of the rs591323 A allele in PD in Taiwanese/Chinese populations.

show abstract

“…SNP IL-6, rs1800795, and IL-8, rs4073, were selected from the GWAS meta-analysis in the PD Gene database (http://www.pdgene.org/gwas (accessed on 9 June 2021)). The SNP genotyping was performed according to the methods described in our previous works [29]. The sequences of specific polymerase chain reaction (PCR) (IL-6 G-174C, rs1800795, forward: GAACACAGAAGAACTCAGATGACTGG reverse: AGGAGTTCATAGCTGGGCTCTG-GAG; IL 8 A-251T, rs4073, forward: CTTATCTTCACCATCATGATAGCATCTG, reverse: GGCTGCCAAGAGAGCCACGGCCAGC) were designed with Assay Designer (version 4.0) (Agena, San Diego, CA, USA).…”

Section: Genetic Analysismentioning

confidence: 99%

Polymorphisms of Interleukin-6 and Interleukin-8 Are Not Associated with Parkinson’s Disease in Taiwan

Liu

Chen

et al. 2021

Brain Sciences

Self Cite

View full text Add to dashboard Cite

Background: Studies have suggested that cytokines are crucial mediators in the pathogenesis of Parkinson’s disease (PD). The multifunctional cytokine interleukin (IL)-6 and its single nucleotide polymorphisms (SNPs) were found to have an impact on the development of PD. However, different studies in associations of IL-6 genetic variants with PD showed inconsistent results and it has never been explored in a Taiwanese population. Both IL-1α and IL-8 contribute to the same inflammation pathway. IL-1α genetic polymorphism has an effect on late-onset PD in Taiwan, whereas the associations of IL-8 genetic variants with PD in Taiwan remain to be investigated. Methods: This study examined the frequencies of polymorphisms within the critical promoter areas of the proinflammatory cytokine genes: IL-6 G-174C (rs1800795) and IL-8 A-251T (rs4073) in Taiwanese PD patients compared with age-and gender-matched healthy subjects. Comparisons were also made in genotype and allele frequencies of IL-6 G-174C (rs1800795) and IL-8 A-251T (rs4073) among different populations in previous studies. Results: In total, 1120 subjects, including 509 PD patients (female/male: 259/250) and 511 control subjects (female/male: 252/259), were recruited. We found no statistically significant differences in IL-6 G-174C (rs1800795) or IL-8 A-251T (rs4073) genotypic and allelic distribution between PD and controls, even after being stratified by age at onset and gender. Conclusions: The results did not demonstrate any association of IL-6 G-174C (rs1800795) or IL-8 A-251T (rs4073) with PD in a Taiwanese population. Despite the negative results, this is the first study in associations of IL-6 G-174C (rs1800795) and IL-8 A-251T (rs4073) with PD in Taiwan. The relevance of genetic variants of IL-6 G-174C (rs1800795) or IL-8 A-251T (rs4073) on PD susceptibility warrants further investigation.

show abstract

Association of RIT2 and RAB7L1 with Parkinson's disease: a case-control study in a Taiwanese cohort and a meta-analysis in Asian populations

Cited by 6 publications

References 30 publications

MAO-B Polymorphism Associated with Progression in a Chinese Parkinson’s Disease Cohort but Not in the PPMI Cohort

MAO-B Polymorphism Associated with Progression in a Chinese Parkinson’s Disease Cohort but Not in the PPMI Cohort

Fibroblast Growth Factor 20 Gene Polymorphism in Parkinson’s Disease in Asian Population: A Meta-Analysis

Polymorphisms of Interleukin-6 and Interleukin-8 Are Not Associated with Parkinson’s Disease in Taiwan

Contact Info

Product

Resources

About