Ataxin-2 and huntingtin interact with endophilin-A complexes to function in plastin-associated pathways

Abstract

Spinocerebellar ataxia type 2 is an inherited neurodegenerative disorder that is caused by an expanded trinucleotide repeat in the SCA2 gene, encoding a polyglutamine stretch in the gene product ataxin-2. Although evidence has been provided that ataxin-2 is involved in RNA metabolism, the physiological function of ataxin-2 remains unclear. Here, we demonstrate that ataxin-2 interacts with two members of the endophilin family, endophilin-A1 and endophilin-A3. To elucidate the physiological implications of these interactions, we exploited yeast as a model system and discovered that expression of ataxin-2 as well as both endophilin proteins is toxic for yeast lacking the SAC6 gene product fimbrin, a protein involved in actin filament organization and endocytotic processes. Intriguingly, expression of huntingtin, another polyglutamine protein interacting with endophilin-A3, was also toxic in Deltasac6 yeast. These effects can be suppressed by simultaneous expression of one of the two human fimbrin orthologs, L- or T-plastin. Moreover, we have discovered that ataxin-2 associates with L- and T-plastin and that overexpression of ataxin-2 leads to accumulation of T-plastin in mammalian cells. Thus, our findings suggest an interplay between ataxin-2, endophilin proteins and huntingtin in plastin-associated cellular pathways.

Ataxin-2 Interacts with the DEAD/H-Box RNA Helicase DDX6 and Interferes with P-Bodies and Stress Granules

“…Plasmids pBTM-ATX2-NTQ22, pBTM-ATX2-NTQ79, pBTM-ATX2-FC (Ralser et al, 2005c), or pBTM-ATX2-FD (Ralser et al, 2005a) or pBTM-htt (Ralser et al, 2005b) were described previously. For the expression in mammalian cells, plasmids encoding MYC-or FLAG-tagged versions of the LSm/LSmAD domain of ATXN2 were generated by isolating the respective DNA fragment from plasmid pGAD-ATXN2-LSm/LSmAD by treatment with SalI/NotI and ligation into the vector pCMV-MYC (SalI/NotI; Clontech, Mountain View, CA) or pTL-FLAG-C (XhoI/NotI), respectively.…”

“…Transfection of plasmids or siRNA molecules was performed as described above. Then, cells were fixed with 2% paraformaldehyde and treated with ice-cold methanol for 10 min and processed as described previously (Ralser et al, 2005c). Preparations were analyzed using a confocal microscope (LSM 510 META; Carl Zeiss, Jena, Germany) on an inverted stand (AxioVert 200M; Carl Zeiss) by using the objective Plan-NEOFLUAR 40ϫ 1.3 oil differential interference contrast.…”

“…Interestingly, cells overexpressing this domain exhibited a delocalization of DDX6 (Figure 4). Finally, to confirm that the observed effects are specific due to an elevated ATXN2 level, we included the endophilin-A3 protein, another interaction partner of ATXN2 (Ralser et al, 2005c), in our studies. In this case, we did not observe any effect on the cellular P-body structures (Figure 4).…”

“…Proteomics-based results demonstrated that PABP and T-plastin, which itself associates with ATXN2, are present together in large protein complexes mostly consisting of proteins involved in RNA processing (Ho et al, 2002;Blagoev et al, 2003). Interestingly, the expression of ATXN2 results in enormous growth defects in yeast deficient for the actin-bundling protein fimbrin, the functional yeast orthologue of the mammalian plastin proteins (Ralser et al, 2005c). Regarding this issue, it is remarkable that the Drosophila melanogaster ATXN2 homologue is a dosage-sensitive regulator of cytoskeletal actin filament formation by controlling translation, stability, or localization of mRNA encoding proteins involved in actin polymerization (Satterfield et al, 2002).…”

“…Then, the resultant DNA fragment was purified and subcloned into pCMV-MYC, which has been treated with EcoRI, T4 DNA polymerase and subsequently with SalI. Plasmid pCMV-MYC-ATXN2-Q79 was generated by subcloning a DNA fragment containing the respective CAG expansion isolated from the plasmid p423GALL-ATXN2-Q79 by treatment with AscI and KpnI (Ralser et al, 2005c) and ligated into the AscI/KpnI sites of pCMV-MYC-ATXN2-Q22.For the generation of plasmids encoding full-length human DDX6 (NM_004397), the corresponding cDNA was amplified from a human fetal cDNA library (Clontech) by using the oligonucleotide pair DDX6-CDS-s-SalI (GAGTCGACAATGGGTCTGTCCAGTCAAAA) and DDX6-as-NotI (TAT-AGCGGCCGCTGTCAAAGCATGCTTGTT). The resultant DNA fragment was treated with the restriction enzymes SalI and NotI and ligated into the SalI/NotI sites of the yeast two-hybrid prey plasmid pACT4 -1b or into the XhoI/NotI sites of the mammalian expression vector pTL-FLAG-C. Underlined primer sequences represent restriction sites.…”