ATP and magnesium drive conformational changes of the Na+/K+-ATPase cytoplasmic headpiece

Abstract

Conformational changes of the Na(+)/K(+)-ATPase isolated large cytoplasmic segment connecting transmembrane helices M4 and M5 (C45) induced by the interaction with enzyme ligands (i.e. Mg(2+) and/or ATP) were investigated by means of the intrinsic tryptophan fluorescence measurement and molecular dynamic simulations. Our data revealed that this model system consisting of only two domains retained the ability to adopt open or closed conformation, i.e. behavior, which is expected from the crystal structures of relative Ca(2+)-ATPase from sarco(endo)plasmic reticulum for the corresponding part of the entire enzyme. Our data revealed that the C45 is found in the closed conformation in the absence of any ligand, in the presence of Mg(2+) only, or in the simultaneous presence of Mg(2+) and ATP. Binding of the ATP alone (i.e. in the absence of Mg(2+)) induced open conformation of the C45. The fact that the transmembrane part of the enzyme was absent in our experiments suggested that the observed conformational changes are consequences only of the interaction with ATP or Mg(2+) and may not be related to the transported cations binding/release, as generally believed. Our data are consistent with the model, where ATP binding to the low-affinity site induces conformational change of the cytoplasmic part of the enzyme, traditionally attributed to E2-->E1 transition, and subsequent Mg(2+) binding to the enzyme-ATP complex induces in turn conformational change traditionally attributed to E1-->E2 transition.

Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

“…The data show that β-phosphate significantly contributes to the affinity of nucleotides to ATPase, while γ-phosphate of ATP does not affect the affinity during complex formation. These data confirm previous suggestions613 regarding the key role of β-phosphate in the formation of Na,K-ATPase complexes with nucleotides. The obtained binding constants for ADP and ATP, are close to the values determined previously714.…”

“…Experiments were carried out at 10, 25, 30 and 37°C in imidazole buffer containing 25 mM imidazole, 1 mM EDTA, 250 mM sucrose, 0.1 mM DTT, and either 3 mM NaCl or 3 mM KCl, pH 7.5. Experiments were conducted in the absence of Mg 2+ , preventing the formation of phosphorylated intermediate13. Absence of ATP hydrolysis by the enzyme was monitored by detecting P i .…”

Na⁺/K⁺-ATPase inhibition by cisplatin and consequences for cisplatin nephrotoxicity

“…The construct was multiplied in DH5α Escherichia coli bacteria and isolated using the NucleoSpin Plasmid (Macherey-Nagel) kit. The sequence was verified by DNA-sequencing using the primers T7-term_Inv (TAGTTATTGCTCAGCGGTGG) and T7-prom (TAATACGACTCACTATAGGG).Heterologous expression in E. coli and purification of isolated C45 was in detail described in our previous manuscript 13 .…”

“…The large cytoplasmic segment connecting the transmembrane helices 4 and 5 (C45 loop, residues Leu 354 -Ile 777 of the mouse brain sequence) with a (His) 6 -tag at the N-terminus was expressed in E. coli Rosetta cells (Promega, USA) and purified using a Co 2+ -based affinity resin (Clontech, USA) as described previously 13 . Immediately after elution, the protein was dialyzed into TBS buffer (20 mM Tris, 140 mM NaCl, pH 7.6) and stored at -20 °C.…”

“…It has also been demonstrated that this isolated C45 retains its functional properties, such as ATP-or TNP-ATP-binding, suggesting that the 3D-structure is preserved 12 . Recently, we reported that the C45 also has dynamic properties that are expected for this part of the molecule within the entire enzyme 13 . This artificial system became popular, because (i) it uncouples the enzyme/nucleotide interaction from the cation transport, which facilitates the data interpretation, and (ii) solubility of the isolated C45 greatly facilitates the experimental work.…”