Automated High-Content Live Animal Drug Screening Using C. elegans Expressing the Aggregation Prone Serpin α1-antitrypsin Z

Abstract

The development of preclinical models amenable to live animal bioactive compound screening is an attractive approach to discovering effective pharmacological therapies for disorders caused by misfolded and aggregation-prone proteins. In general, however, live animal drug screening is labor and resource intensive, and has been hampered by the lack of robust assay designs and high throughput work-flows. Based on their small size, tissue transparency and ease of cultivation, the use of C. elegans should obviate many of the technical impediments associated with live animal drug screening. Moreover, their genetic tractability and accomplished record for providing insights into the molecular and cellular basis of human disease, should make C. elegans an ideal model system for in vivo drug discovery campaigns. The goal of this study was to determine whether C. elegans could be adapted to high-throughput and high-content drug screening strategies analogous to those developed for cell-based systems. Using transgenic animals expressing fluorescently-tagged proteins, we first developed a high-quality, high-throughput work-flow utilizing an automated fluorescence microscopy platform with integrated image acquisition and data analysis modules to qualitatively assess different biological processes including, growth, tissue development, cell viability and autophagy. We next adapted this technology to conduct a small molecule screen and identified compounds that altered the intracellular accumulation of the human aggregation prone mutant that causes liver disease in α1-antitrypsin deficiency. This study provides powerful validation for advancement in preclinical drug discovery campaigns by screening live C. elegans modeling α1-antitrypsin deficiency and other complex disease phenotypes on high-content imaging platforms.

Histone Deacetylase Inhibitor (HDACi) Suberoylanilide Hydroxamic Acid (SAHA)-mediated Correction of α1-Antitrypsin Deficiency

“…Rather, we would suggest that SAHA would have its main effect on the protection and/or restoration of lung function through the increased generation of a soluble secreted, functional pool (14,105,110). However, because HDACi have recently been reported to induce autophagy (111), the potential impact of select HDACi on aggregate load in the hepatocyte disease will require further investigation.…”

Clozapine Modulates Glucosylceramide, Clears Aggregated Proteins, and Enhances ATG8/LC3 in Caenorhabditis elegans

“…Some APDs clear aggregated proteins in C. elegans (Gosai et al, 2010;Li et al, 2014;McCormick et al, 2013). Thus, we examined whether clozapine was able to clear aggregated proteins, using a worm strain that carries YFP-labeled α-synuclein driven by the unc-54 promoter expressed in muscles.…”

The Aggregation-Prone Intracellular Serpin SRP-2 Fails to Transit the ER inCaenorhabditis elegans

“…A P srp-2 srp-2::GFP expression construct was generated by ligating a 5.5-kb srp-2 promoter region (forward primer, TTTAATAAGCTTTAGTTTCAGATGGTGG; reverse primer, TATATAAAGCTTGTCGGAAAATTATGACACTTTTGG), the full-length srp-2 gene (minus the stop codon), and the 0.85-kb GFP fragment into the canonical expression vector pPD49.26 (kind gift from Andrew Fire) as previously described . A P srp-2 sGFP::ATM expression construct was generated by replacing the nhx-2 promoter in the plasmid P nhx-2 sGFP::ATM with the srp-2 promoter as described in Gosai et al (2010).…”

“…Transgenic strains were generated by injecting the respective plasmids into the gonad of young adult N2 hermaphrodites at a final concentration 100 ng/ml. The P nhx-2 sGFP::ATZ expression vector was generated as previously described (Gosai et al 2010;Long et al 2014). P nhx-2 GFP::ATZ (cytoplasmic) was generated by mutating the ATG of the signal peptide to a KpnI restriction enzyme recognition site, causing translation to begin at the start of GFP.…”