Autophagy Delays Apoptotic Cell Death Induced by Siniperca chuatsi Rhabdovirus in Epithelioma Papulosum Cyprinid Cells

Abstract

Autophagy and apoptosis are two key cell fate determination pathways, which play vital roles in the interaction between viruses and host cells. Previous research had confirmed that one strain of fish rhabdoviruses, Siniperca chuatsi rhabdovirus (SCRV), could induce apoptosis and autophagy after infection. In the current study, we continued to analyze the interaction of autophagy and apoptosis in SCRV-infected EPC cell lines after treatment with different autophagy or apoptosis inhibitors. We found that SCRV infection could activate the mitochondrial apoptotic pathway by the detection of the activities of the caspase-3 and caspase-9 and by flow cytometry analysis in JC-1-stained cells, respectively. Furthermore, no significant autophagy-related factors were disturbed in SCRV-infected cell after apoptosis inhibitor Z-VAD-FMK treatment, while autophagy inducer rapamycin could obviously delay the occurrence of CPE and cell death. Meanwhile, rapamycin was able to reduce the proportion of apoptotic cells. Besides that, rapamycin could disturb the expression of p62 and LC3B-II, and the transcription level of SCRV nucleoprotein mRNA. The progeny virus titers did not show a big difference between the rapamycin treatment or without it. Collectively, our data preliminarily confirmed that SCRV-activated autophagy could delay apoptosis in EPC cells and may not affect virus production. Further study may need to focus on the crosstalk regulation and its roles on the SCRV infection.

Investigation of the Antiviral Mechanism of Curcumin Analog EF-24 against Siniperca cachuatsi Rhabdovirus

“…Our previous report demonstrated that SCRV could induce mitochondrial apoptosis in EPC cells by increasing caspase-3 and caspase-9 activities, downregulating MMP, and increasing intracellular ROS [17]. Given its central role in cell apoptosis, MMP loss is a marker of mitochondrial apoptosis.…”

“…EPC cells were treated with EF-24 and SCRV viruses at different exposure sequences for 12 h and 24 h. Total RNA samples of the treated cells were extracted according to an experimental procedure recommended by the reagent kit manufacturer (Beijing Tsingke Biotech Co., Ltd., Beijing, China) and then reverse-transcribed into cDNAs. PCR experiments were performed using the following primer sequences: N-F. ATCCATCAGATCACAGAACGC, N-R: TCCCAGCCATTCTCCTCAGTCC, 18s-F: CATTCGTATTGTGCCGCTAGA, 18s-R: CAAATGCTTTCGCTTTGGTC [17]. The thermal cycling conditions were as follows: predenaturation (30 s at 95 • C), followed by 40 extension cycles (10 s at 95 • C, 15 s at 60 • C), and solubility curves (15 s at 95 • C, 60 s at 60 • C, 15 s at 95 • C).…”

“…Siniperca chuatsi rhabdovirus (SCRV) was isolated and characterized from cultured turbot Scophthalmus maximus Linaeus, which is associated with lethal hemorrhagic disease [16]. Mechanically, we conducted pathogenic mechanism research and found that SCRV infection activated autophagy and apoptosis in one fish cell line and epithelioma papulosum cyprinid cells (EPC), whose interplay was also investigated [17]. Moreover, we also screened potential antiviral molecules and studied their anti-SCRV activities according to regular protocols [2].…”

Effect of Fluoride on Cytotoxicity Involved in Mitochondrial Dysfunction: A Review of Mechanism

“…Autophagy mainly plays a survival role in adapting to unfavorable growth conditions or subsequent cell stress ( 133 ). It is mainly involved in differentiation, development, pathogen defense, aging, apoptosis and cell death ( 134 , 135 ). Autophagy plays a significant role in cell protection under physiological conditions ( 136 ).…”