Autoradiography using storage phosphor technology

Johnston, Richard F.; Pickett, Siobhan C.; Barker, David

doi:10.1002/elps.1150110503

Cited by 517 publications

(242 citation statements)

References 9 publications

Supporting

Mentioning

242

Contrasting

Order By: Relevance

“…Method: Ribonuclease protection assays were performed using the RPA III kit (Ambion), according to manufacturer's instructions. After electrophoresis, the amount of protected fragments were quantified using a Storm 860 storage phosphor system (Johnson et al, 1990) with ImageQuant 4.2 software (Molecular Dynamics, Sunnyvale, CA). Antisense fgf8 probe was generated by amplifying a fragment of the fgf8 cDNA using the following primers: TTACACAGCATGTGAGTGAGC, GTACTTCACATTCTGCAGAGC.…”

Section: Figmentioning

confidence: 99%

Inhibition of zebrafish fgf8 pre‐mRNA splicing with morpholino oligos: A quantifiable method for gene knockdown

Draper

Morcos

Kimmel

2001

Genesis

336

226

View full text Add to dashboard Cite

Antisense morpholino oligonucleotides (MO) have been used successfully in zebrafish and Xenopus to knock down gene function by gene-specific inhibition of mRNA translation (Ekker, 2000). In addition to their ability to block cytosolic processes, MO can enter the nucleus (Partridge et al., 1996) and have been shown to be effective inhibitors of pre-mRNA splicing in mammalian tissue-culture cell lines (Schmajuk et al., 1999). We show here that MO efficiently block pre-mRNA splicing in zebrafish embryos. Splice-blocking MO have the advantages that the efficacy of gene knockdown can be quantified without the use of antibodies, and that they specifically target zygotic, and not maternal, transcripts.We targeted the fgf8 gene (Furthauer et al., 1997;Reifers et al., 1998) with splice-blocking MO. An ENU induced mutation in fgf8, acerebellar (ace; referred to here as fgf8 it282 ), has previously been described (Reifers et al., 1998). fgf8 it282 is a splice donor mutation that results in the production of an aberrantly spliced mRNA (Reifers et al., 1998). Hence, blocking the same splicing event using MO should result in a phenotype similar to fgf8 it282 .We determined the fgf8 exon/intron structure and designed two 25-mer MO complementary to the exon 2 and exon 3 splice donor sites (designated E2I2 and E3I3, respectively; Fig. 1a). Both MO span the exon/intron junction, including the most conserved residues of the splice donor consensus sequence (Fig. 1 legend).We first asked whether splice site-targeted MO can alter splicing of fgf8 mRNA. Using reverse transcriptase polymerase chain reaction, we found that injection of the E3I3 MO into early zebrafish embryos results in the production of two aberrantly spliced messages we term variant 1 and 2 (Fig. 1a, b). Sequence analysis of the corresponding cDNAs revealed that variant 1 results from excluding exon 3, whereas variant 2 results from the use of a cryptic splice donor located 32 bases 5Ј of the normal exon 3 splice donor (Fig. 1c). Use of the cryptic splice donor creates a premature termination codon at the novel splice junction (Fig. 1c). Additionally, we found that injected splice site-targeted MO only alter the structure of zygotically expressed, but not maternally supplied, mRNA, as expected (Fig. 2d). Thus, E3I3 can

show abstract

Section: Figmentioning

confidence: 99%

Inhibition of zebrafish fgf8 pre‐mRNA splicing with morpholino oligos: A quantifiable method for gene knockdown

Draper

Morcos

Kimmel

2001

Genesis

336

226

View full text Add to dashboard Cite

show abstract

“…Blots were then washed with 95% ethanol and air-dried (35). Incorporation of [ 32 P]dTTP was measured using the PhosphorImager system (Molecular Dynamics) (36).…”

Section: Measurement Of Hiv-1 Replicationmentioning

confidence: 99%

Peroxisome Proliferator-activated Receptor γ Agonists Inhibit HIV-1 Replication in Macrophages by Transcriptional and Post-transcriptional Effects

Hayes¹,

Lane²,

King³

et al. 2002

Journal of Biological Chemistry

View full text Add to dashboard Cite

“…The resulting pellets were washed twice with cold, water-saturated ether and were resolved by electrophoresis in a 10% SDS/ polyacrylamide gel [31]. Radioactivity was determined using the phosphor imager system (Molecular Dynamics) [32], or gel slices were excised and counted using liquid-scintillation counting. Autoradiographs were obtained after exposing (-80°C) the gels overnight to KODAK X-ray films.…”

Section: Adp-ribosylationmentioning

confidence: 99%

Characterization of a nitric‐oxide‐catalysed ADP‐ribosylation of glyceraldehyde‐3‐phosphate dehydrogenase

Dimmeler

Brüne

1992

European Journal of Biochemistry

128

102

View full text Add to dashboard Cite

Auto-ADP-ribosylation of the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GraPDH) has recently been demonstrated to be dramatically stimulated in the presence of nitric oxide. In order to obtain insight into the sequence of events leading to ADP-ribosylation of GraPDH, we studied the target amino acid, the nucleotide cofactor requirement, pH dependency and the stoichiometry of the reaction. Basal as well as stimulated ADP-ribose transfer is inhibited by the SH-group alkylating reagent, N-ethylmaleimide. Furthermore, the radiolabel of a~t o -[~~P ] A D pribosylated GraPDH is removed by treatment with HgC12, suggesting an ADP-ribose -cysteine bond. Several indirect and direct mechanistic considerations point to NAD' as the only cofactor for the ADP-ribosylation reaction, excluding the possibility of a reaction sequence involving a NADglycohydrolase(s) followed by nonenzymatic ADP-ribose transfer to GraPDH. Optimal ADPribosylations were carried out at alkaline pH values using 10 pM free NAD' as the sole nucleotide cofactor. Bovine serum albumin with an S-nitrosylated SH group can serve as a model of ADP-ribose transfer from NAD' and suggests that the nitric-oxide-modified SH group (S-nitrosylated SH group) is a prerequisite for the reaction. In a previous work, we demonstrated that nitric oxide was able to increase the mono-ADP-ribosylation of a 39-kDa cytosolic protein [18, 191, which was observed not only when nitric oxide was released from pharmacological compounds like sodium nitroprusside (SNP) or 3-morpholino-sydnonimine (SIN-l), but also when nitric oxide was generated from its physiological precursor L-arginine, by the enzymic activity of the nitric oxide synthase [22]. Nitric-oxide-stimulated ADP-ribosylation was recently confirmed by two other groups, using cerebral cortex and erythrocyte membranes [21, 231. These studies may suggest that endogenous ADP-ribosylation is under the regulatory control of second messenger systems, especially nitric oxide. Activation of nitric oxide synthase [24] in its various isoforms [25] produces nitric oxide, initially characterized as the endothelium-derived relaxing factor [26]. While some nitric oxide effects are mediated by binding of nitric oxide to the heme subunit of soluble guanylate cyclase, thus increasing cGMP [27], the stimulatory effects concerning the mono-ADPribosylation are cGMP independent and might be linked to higher and hence pathophysiological and cytotoxic nitric oxide conditions [28, 291. Our studies now further characterize this nitric-oxidecatalysed mono-ADP-ribosylation of GraPDH and explore some mechanistics of the ADP-ribose-transfer reaction. We would like to stress the importance of reduced thiol groups as a prerequisite for ADP-ribosylation, furthermore we would like to report on cysteine-specific modification, pH dependency and the specificity of NAD+, required for this ADPribosylation reaction.

show abstract

Autoradiography using storage phosphor technology

Cited by 517 publications

References 9 publications

Inhibition of zebrafish fgf8 pre‐mRNA splicing with morpholino oligos: A quantifiable method for gene knockdown

Inhibition of zebrafish fgf8 pre‐mRNA splicing with morpholino oligos: A quantifiable method for gene knockdown

Peroxisome Proliferator-activated Receptor γ Agonists Inhibit HIV-1 Replication in Macrophages by Transcriptional and Post-transcriptional Effects

Characterization of a nitric‐oxide‐catalysed ADP‐ribosylation of glyceraldehyde‐3‐phosphate dehydrogenase

Contact Info

Product

Resources

About