Bacterial Genetics

Avison, Matthew B; Bennett, Peter M.

doi:10.1002/9780470688618.taw0004

Cited by 2 publications

(3 citation statements)

References 324 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Changes can be made to a bacterium's genetic inheritance in two ways; (1) by mutations that alter the pre‐existing DNA of the cell—these alterations, base changes and DNA deletions and inversions ( Avison and Bennett, 2005 ), change genes already possessed but do not add new genes, that is new DNA, to the cell genome—and (2) by acquisition of new genetic material, that is capture of genes new to the cell, which expands the genome. This article examines the latter mechanism, which is largely, although not exclusively, responsible for the development of antibiotic‐resistant variant strains of bacteria, which cause infections of man and animals.…”

Section: Introductionmentioning

confidence: 99%

Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria

Bennett

2008

British J Pharmacology

729

497

View full text Add to dashboard Cite

Bacteria have existed on Earth for three billion years or so and have become adept at protecting themselves against toxic chemicals. Antibiotics have been in clinical use for a little more than 6 decades. That antibiotic resistance is now a major clinical problem all over the world attests to the success and speed of bacterial adaptation. Mechanisms of antibiotic resistance in bacteria are varied and include target protection, target substitution, antibiotic detoxification and block of intracellular antibiotic accumulation. Acquisition of genes needed to elaborate the various mechanisms is greatly aided by a variety of promiscuous gene transfer systems, such as bacterial conjugative plasmids, transposable elements and integron systems, that move genes from one DNA system to another and from one bacterial cell to another, not necessarily one related to the gene donor. Bacterial plasmids serve as the scaffold on which are assembled arrays of antibiotic resistance genes, by transposition (transposable elements and ISCR mediated transposition) and site‐specific recombination mechanisms (integron gene cassettes). The evidence suggests that antibiotic resistance genes in human bacterial pathogens originate from a multitude of bacterial sources, indicating that the genomes of all bacteria can be considered as a single global gene pool into which most, if not all, bacteria can dip for genes necessary for survival. In terms of antibiotic resistance, plasmids serve a central role, as the vehicles for resistance gene capture and their subsequent dissemination. These various aspects of bacterial resistance to antibiotics will be explored in this presentation. British Journal of Pharmacology (2008) 153, S347–S357; doi:; published online 14 January 2008

show abstract

Section: Introductionmentioning

confidence: 99%

Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria

Bennett

2008

British J Pharmacology

729

497

View full text Add to dashboard Cite

show abstract

“…The lysP gene was disrupted in the same way using primers lysP‐Mu‐F (5′‐TTATAACCGCGCATTTGTGTCGGAAGGATAGTATTTCGTCGTGTAGGCTGGAGCTGCTTC‐3′) and lysP‐Mu‐R (5′‐ACCGGAGGTGTTTAACAGCCACAGATAGACCGTCTGGTTGCATATGAATATCCTCCTTAG‐3′). Salmonella strains YK5005 ( cadA :: lacZ Δ cadC ), YK5006 ( cadA :: lacZ Δ lysP ) and YK5009 ( STM4538 ::Tn10 d Cm) were constructed using phage P22‐mediated generalized transduction as previously described (Davis et al ., ). Bacteriophage P22HT int 105 was propagated in a donor strain (JF3068 or YK5007) and used to infect the recipient strain (YK5002, YK5004 or UK1 wild‐type).…”

Section: Methodsmentioning

confidence: 97%

“…The phenotype was confirmed by moving the mutations into the parent S . Typhimurium strain using P22‐mediated transduction (Davis et al ., ). The sites of Tn10 d Cm insertion in the chromosome were amplified using arbitrary primed PCR with primers Cat1/Arb1 and Cat2/Arb2 and sequenced using primer Cat2 (Welsh & McClelland, ).…”

Section: Methodsmentioning

confidence: 97%

A phosphotransferase system permease is a novel component of CadC signaling inSalmonella enterica

Lee

Kim

et al. 2012

FEMS Microbiol Lett

View full text Add to dashboard Cite

In Salmonella enterica serovar Typhimurium, proteolytic cleavage of the membrane-bound transcriptional regulator CadC acts as a switch to activate genes of the lysine decarboxylase system in response to low pH and lysine signals. To identify the genetic factors required for the proteolytic activation of CadC, we performed genome-wide random mutagenesis. We show that a phosphotransferase system (PTS) permease STM4538 acts as a positive modulator of CadC function. The transposon insertion in STM4538 reduces the expression of the CadC target operon cadBA under permissive conditions. In addition, deletional inactivation of STM4538 in the wild-type background leads to the impaired proteolytic cleavage of CadC. We also show that only the low pH signal is involved in the proteolytic processing of CadC, but the lysine signal plays a role in the repression of the lysP gene encoding a lysine-specific permease, which negatively controls expression of the cadBA operon. Our data suggest that the PTS permease STM4538 affects proteolytic processing, which is a necessary but not sufficient step for CadC activation, rendering CadC able to activate target genes.

show abstract

Bacterial Genetics

Cited by 2 publications

References 324 publications

Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria

Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria

A phosphotransferase system permease is a novel component of CadC signaling inSalmonella enterica

Contact Info

Product

Resources

About