Bacterial transcription factors involved in global regulation

Abstract

SummaryThe presence of intricate global cell regulation mechanisms may be one reason for the exceptional environmental and evolutionary success of microbes. Promoters, the cis-acting signals, are responsive to several stimuli related to growth, stress and substrate speci®city. Their response is mediated by a wide variety of trans-acting regulators that sense the environment and the physiological state of the cell and adjust the transcription of speci®c genes. One of the main transcriptional regulation webs operates in the transition from af¯uent to barren conditions, with s S being the chief actor in a company of players that stage a competition for the sparsely available RNA polymerase molecules. In this role, s S may be assisted by several factors, including nucleoid-related proteins and metabolites. In addition, the levels of s S itself are regulated by mechanisms that include inactivation and degradation. Several transcription factors, belonging to different regulatory pathways, may operate in the same promoter. In such a case, the ®nal transcriptional output depends both on the interplay of effectors and on the properties of the recruitment of the effector±RNA polymerase complex to the promoter. RNA polymerase itself is also capable of establishing selective interactions with activators and speci®c promoter regions through the carboxy-terminal domain of its alpha subunit (aCTD). Transcriptional regulation controls pervade such crucial events in the life of bacterial cells as Escherichia coli cell division, Bacillus subtilis sporulation and Caulobacter crescentus differentiation. These examples suggest that bacteria have been particularly inventive in adapting gene expression regulation to survive under a diversity of environments and have done so by exploiting the malleable molecular mechanisms involved in transcription, developing complexities that may match those found in eukaryotic cells.

The essential two-component regulatory system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis

“…In addition, at least two transcriptional activators -SdiA, which is a part of a quorum-sensing pathway, and RcsB, which is involved in the regulatory pathway of capsular polysaccharide biosynthesis -have been found to modulate ftsZ expression (reviewed by Vicente et al, 1999). In B. subtilis, three promoter sequences for ftsZ expression were identified, and our results show that YycF is the transcriptional factor with the potential to regulate ftsZ expression.…”

SmcR and Cyclic AMP Receptor Protein Coactivate Vibrio vulnificus vvpE Encoding Elastase through the RpoS-dependent Promoter in a Synergistic Manner

“…The assigned sequences for the UP element (AAAACATTTTTTTGGTGAAGTT) scored an 86% homology to the UP element consensus sequences of the promoters recognized by the ␣-CTD of the RNAP in E. coli (39). It has been suggested that class I activators stimulate transcription with promoters by contacting the ␣-subunit of RNAP (40). However, it seems likely that 220 and 198 bp upstream of the transcription start site are still unusually large distances for class I activation of promoters.…”

Nucleotides from –16 to –12 Determine Specific Promoter Recognition by Bacterial σS-RNA Polymerase

“…Indeed, studies of different S -dependent promoters suggest that other parameters such as increased intracellular salt concentration, degree of DNA supercoiling, the ppGpp alarmone, and modulation by trans-acting regulators all contribute to S selectivity (reviewed in Refs. [11][12][13][14][15]. The main sequence feature specific for S -dependent promoters would be a C nucleotide immediately upstream of the Ϫ10 promoter element (CTATA(c/a)T at the Ϫ13 position relative to the transcription start (Ϫ13C)); the Ϫ35 element does not appear to be important for promoter recognition by S , although conflicting data on its role have been reported (10, 16 -19).…”