Barcoding Analysis of Paraguayan Squamata

Cacciali, Pier; Buongermini, Emilio; Köhler, Günther

doi:10.3390/d11090152

Cited by 5 publications

(6 citation statements)

References 69 publications

(57 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We extracted genomic DNA following the standard single-tube salt extraction protocol (Bruford et al 1992). To do so, we cut small pieces from the collected tissue and proceeded to protein digestion following the protocol of Cacciali et al (2019). We then passed the extracted DNA to a PCR (Polymerase Chain Reaction) thermocycler, in which we amplified DNA fragments of two mitochondrial genes, "16S" (Vences et al 2005) and "COI" with the primers 16SAL (5´-CGCC TGTTTATCAAAAACAT-3´) and 16SBH (5´-CCGGTCT GAACTCAGATCACGT-3´) from Palumbi et al (1991).…”

Section: Species Identification With Dna Barcodesmentioning

confidence: 99%

Differential responses of amphibians and reptiles to land‐use change in the biodiversity hotspot of north‐eastern Madagascar

Fulgence

Martin

Randriamanantena

et al. 2021

Animal Conservation

View full text Add to dashboard Cite

Large expanses of tropical rainforest have been converted into agricultural landscapes cultivated by smallholder farmers. This is also the case in north-eastern Madagascar; a region that retains significant proportions of forest cover despite slash-and-burn shifting hill rice cultivation and vanilla agroforestry expansion. The region is also a global hotspot for herpetofauna diversity, but how amphibians and reptiles are affected by land-use change remains largely unknown. Using a spacefor-time study design, we compared species diversity and community composition across seven prevalent land uses: unburned (old-growth forest, forest fragment, and forest-derived vanilla agroforest) and burned (fallow-derived vanilla agroforest, woody fallow, and herbaceous fallow) land-use types, and rice paddy. We conducted six comprehensive, time-standardized searches across at least 10 replicates per land-use type and applied genetic barcoding to confirm species identification. We documented an exceptional diversity of herpetofauna (119 species; 91% endemic). Observed plot-level amphibian species richness was significantly higher in old-growth forest than in all other land-use types. Plot-level reptile species richness was significantly higher in unburned land-use types compared with burned land-use types. For both amphibians and reptiles, the less-disturbed land-use types showed more uneven communities and the species composition in old-growth forest differed significantly from all other land-use types. Amphibians had higher forest dependency (38% of species occurred exclusively in old-growth forest) than reptiles (26%). Our analyses thus revealed that the two groups respond differently to land-use change: we found less pronounced losses of reptile species richness especially in unburned agricultural habitats, suggesting that reptiles are less susceptible to land-use change than amphibians, possibly due to their ability to cope with hotter and drier microclimates. In conclusion, our findings emphasize existing conservation opportunitiesespecially for reptilesin extensive agricultural landscapes while highlighting the precarious situation of amphibians in disappearing old-growth forests.

show abstract

Section: Species Identification With Dna Barcodesmentioning

confidence: 99%

Differential responses of amphibians and reptiles to land‐use change in the biodiversity hotspot of north‐eastern Madagascar

Fulgence

Martin

Randriamanantena

et al. 2021

Animal Conservation

View full text Add to dashboard Cite

show abstract

“…Currently GenBank has genetic sequences for only two species in the nasutus group (Phalotris nasutus and P. lativittatus), thus efforts still need to be made to collect tissue samples from the remaining species. Unfortunately, snakes are among the least sampled animals, and data on genetics is missing not only within the genus Phalotris, but also for most of the Paraguayan snakes (Cacciali et al 2019).…”

Section: Discussionmentioning

confidence: 99%

A new species of Phalotris (Serpentes, Colubridae, Elapomorphini) from Paraguay

Smith¹,

Brouard²,

Cacciali³

2022

ZSE

Self Cite

View full text Add to dashboard Cite

A new species of Phalotris from the nasutus group, Phalotris shawnellasp. nov., is described. It can be distinguished from the other members of the group by having the following combination of characters: 1) fifth supralabial in contact with parietal, 2) vertebral stripe present, 3) yellowish nuchal collar (2 or 3 dorsal scales long), 4) dull reddish color of head, 5) broad, solidly or near solidly dark, lateral bands, 6) red-orange ventral scales lightly and irregularly spotted with black mainly on the posterior half of the body and 7) a bilobed, extremely asymmetrical hemipenis, with enlarged, curved, lateral spines. The species is only known from a recent specimen collected in the Cerrado zone of northeastern Paraguay at Rancho Laguna Blanca, San Pedro department, and two photographic records of live specimens from this and an additional locality. Limited ecological data based on observations of a captive individual, and a wild record, are provided, and a conservation assessment is performed for this extremely limited range Paraguayan endemic snake.

show abstract

“…We extracted genomic DNA following the standard single-tube salt extraction protocol (Bruford et al 1992). To do so, we cut small pieces from the collected tissue and proceeded to protein digestion following the protocol of Cacciali et al (2019). We then passed the extracted DNA to a PCR (Polymerase Chain Reaction) thermocycler, in which we amplified DNA fragments of two mitochondrial genes, “16S” (Vences et al 2005) and “COI” with the primers 16SAL (5’ s - CGCCTGTTTATCAAAAACAT - 3’) and 16SBH (5’ - CCGGTCTGAACTCAGATCACGT - 3’) from Palumbi et al (1991).…”

Section: Methodsmentioning

confidence: 99%

Differential responses of amphibians and reptiles to land-use change in the biodiversity hotspot of north-eastern Madagascar

Fulgence

Martin

Randriamanantena

et al. 2021

Preprint

View full text Add to dashboard Cite

Large expanses of tropical rainforest have been converted into agricultural landscapes cultivated by smallholder farmers. This is also the case in north-eastern Madagascar; a region that retains a significant proportions of forest cover despite shifting hill rice cultivation and vanilla agroforestry. The region is also a global hotspot for herpetofauna diversity, but how this diversity is affected by land-use change remains largely unknown. Using a space-for-time study design to uncover land-use effects, we compared species diversity and community composition in seven prevalent land uses: unburned (old-growth forest, forest fragment, and forest-derived vanilla agroforest) and burned (fallow-derived vanilla agroforest, woody fallow, herbaceous fallow) land-use types, and rice paddy. We conducted six comprehensives, time-standardized searches across at least ten replicates of each land-use type and applied genetic barcoding to confirm species identification. We documented an outstanding diversity of endemic herpetofauna (119 species): amphibian species richness at the plot level was highest in old-growth forest and significantly lower in all other land-use types. Plot-level reptile species richness was significantly higher in the unburned land-use types than burned land-use types. For both amphibians and reptiles, the less-disturbed land-use types showed more uneven communities and particularly in old-growth forest, the species composition differed significantly from all other land-use types. Amphibians showed a higher level of forest dependency compared to reptiles (38% versus 28% of species exclusively occurred in old-growth forest). Our analyses thus revealed that the two groups respond differently to land-use change: we found less pronounced losses of reptile species richness especially in unburned agricultural habitats, suggesting that reptiles are less susceptible to land-use change than amphibians. Overall, old-growth forest harboured a unique diversity, but some species also thrived in agroforestry systems, especially if these were forest-derived. This highlights the importance of conserving old-growth forests and non-burned land-use types within the agricultural landscape.

show abstract

Barcoding Analysis of Paraguayan Squamata

Cited by 5 publications

References 69 publications

Differential responses of amphibians and reptiles to land‐use change in the biodiversity hotspot of north‐eastern Madagascar

Differential responses of amphibians and reptiles to land‐use change in the biodiversity hotspot of north‐eastern Madagascar

A new species of Phalotris (Serpentes, Colubridae, Elapomorphini) from Paraguay

Differential responses of amphibians and reptiles to land-use change in the biodiversity hotspot of north-eastern Madagascar

Contact Info

Product

Resources

About