Behavioral effects of prenatal ketamine exposure in rhesus macaques are dependent on MAOA genotype.

Abstract

Ketamine is an NMDA receptor antagonist that is used in anesthetic, abuse, and therapeutic contexts. Recent evidence suggests that ketamine may affect not only glutamate systems, but may also act on receptors in the dopamine and serotonin systems. Because monoamine neurotransmitters play important trophic roles in prenatal development, we hypothesized that the behavioral consequences of prenatal exposure to ketamine may be moderated by genotype of the promoter in the monoamine oxidase-A (MAOA) gene. Eighty-two infant rhesus monkeys were identified that had known dates of conception and exposures to ketamine during gestation. Animals were tested at 3–4 months of age on a battery of tests assessing responsiveness to maternal separation, recognition memory, and contact with novel objects. Animals were classified by putative activity levels for the MAOA genotype. The effects of prenatal ketamine exposure were seen only in the context of MAOA genotype. Greater exposure to ketamine resulted in increased activity, less willingness to perform in the memory task, and reduced emotionality and novel object contact, but only for individuals with the low-activity genotype. Nearly all effects of exposure to ketamine were found in the first and second trimesters. MAOA genotype moderates the role of prenatal ketamine exposure at time points in gestation earlier than have been shown in past research, and are particularly evident for measures of emotionality. These results support the idea that the ketamine’s use might be best considered in light of individuals’ genetic characteristics.

Consistent inter‐individual differences in common marmosets (Callithrix jacchus) in Boldness‐Shyness, Stress‐Activity, and Exploration‐Avoidance

“…Afterwards, consistency across time, contexts and situations can be quantitatively measured, which makes this method reliable and reasonably objective, and also allows cross‐species comparisons. To date, several non‐human primate studies have used this approach to assess personality [Capitanio, ; Capitanio et al, ; Carter et al, ; Dammhahn, ; Fairbanks, ; Hebb, ; Koski & Burkart, ; Massen et al, ; Schneider et al, ; Stevenson‐Hinde et al, ; Uher et al, , ]. For instance, Massen and colleagues [] tested 29 adult chimpanzees in a group setting in a battery of ten experiments.…”

Sleep disturbance as detected by actigraphy in pre-pubertal juvenile monkeys receiving therapeutic doses of fluoxetine

“…Subjects were genotyped for behaviorally relevant polymorphisms of the serotonin transporter (SERT, 5HTTLPR VNTR polymorphisms) and serotonin metabolizing enzyme monoamine oxidase A (MAOA, uVNTR polymorphisms) (Kinnally et al, 2008; Capitanio et al, 2012). Treatment groups were balanced for polymorphisms resulting in different transcription rates for these genes (5HTTLPR: SS, SL, LL groups; MAOA: hi-MAOA, low-MAOA groups) (Lesch et al, 1997; Newman et al, 2005).…”

Bone growth in juvenile rhesus monkeys is influenced by 5HTTLPR polymorphisms and interactions between 5HTTLPR polymorphisms and fluoxetine

“…Genotyping is conducted by the Veterinary Genetics Laboratory at UC Davis using polymerase chain reaction (PCR) with primers MAOA-Forward: CAGAAACATGAGCACAAACG (FAM labeled), MAOA-Reverse: TACGAGGTGTCGTCCAAGTT, SERT-Forward GGCGTTGCCGCTCT GAATGC and SERT reverse GAGGGACTGAGCTGGACAACCAC [32, 33]. The MAOA polymorphisms were characterized for high and low transcription rates in rhesus [34], and 5HTTLPR polymorphisms as originally classified for high (long, L) or low (short, S) transcription in humans by Lesch [35] and extended to similar polymorphisms in rhesus [36].…”