Biallelic somatic inactivation of the mismatch repair gene MLH1 in a primary skin melanoma

Abstract

Inactivation of mismatch repair (MMR) genes has been linked to the hereditary nonpolyposis colon cancer syndrome and to a subset of sporadic cancers. A phenotypic characteristic of tumors with defective MMR is microsatellite instability (MSI). Although MSI has been reported in a proportion of cutaneous melanomas, inactivation of MMR genes in this tumor type has not been detected thus far. We recently described a human melanoma cell line, PR-Mel, and a cutaneous metastasis from the same patient, which displayed a MMR defect, and showed high MSI. Here we report that in the PR-Mel cell line both MLH1 alleles are somatically inactivated. One allele is lost through a chromosomal deletion of the region 3p21-24, whereas the remaining allele harbors a G --> A transition at position -1 of the acceptor splice site of intron 15, leading to the in-frame skipping of exon 16. The primary melanoma of the PR patient shows loss of heterozygosity at the BAT21 microsatellite marker, located in the MLH1 gene, and does not express the MLH1 and PMS2 proteins. Moreover, it harbors the same mutation detected in the PR-Mel cells. These results demonstrate that biallelic inactivation of MLH1 had occurred in the primary melanoma of the PR patient and suggest that disruption of MMR might have had a role in the development of the melanoma. This is the first report in which genetic defects leading to disruption of MMR function in a human melanoma have been identified.

MicroRNA‐155 targets the SKI gene in human melanoma cell lines

“…Reverse transcription of total RNA purified from GL‐Mel and SK‐Mel‐28 cell lines was performed as previously described (Castiglia et al., 2003). The resulting cDNA was amplified with primers (F) 5′‐ACGAGGCACTGACCTGCGTC and (R) 5′‐GGCAGATTCAGTCGCTACTG, spanning a 482‐bp region of SKI 3′UTR containing miR‐155 ‐binding site.…”

Coevolution between simple sequence repeats (SSRs) and virus genome size

“…It is now accepted that unstable maintenance of microsatellites occurs in about 15% of sporadic colorectal cancers [28,29]. Microsatellite instability is also frequently associated with other diseases such as ovarian cancers, malignant tumors of endometrium [30], small intestine [29], stomach [31], skin [32] and brain, etc. The features of microsatellite instability observed in bacteria, yeast, mice and man can provide general clues as to how genomes evolve and how certain instability could contribute to human disease [17].…”

Features of trinucleotide repeat instability in vivo

“…The most common underlying cause of microsatellite instability in HNPCC is germ line mutation in one or more components of the mismatch repair (MMR) system [13][14][15][16]. It is now accepted that unstable maintenance of microsatellite repeats occurs in about 15% of sporadic colorectal cancers [13][14][15][16][17][18][19][20][21][22][23][24][25][26]. Microsatellite instability is also frequently associated with ovarian cancers [17,21,22] and other malignancies, including tumors of endometrium [22,23], skin [24], brain [25], stomach [23,26,27] and small intestine [26] among others.…”

“…It is now accepted that unstable maintenance of microsatellite repeats occurs in about 15% of sporadic colorectal cancers [13][14][15][16][17][18][19][20][21][22][23][24][25][26]. Microsatellite instability is also frequently associated with ovarian cancers [17,21,22] and other malignancies, including tumors of endometrium [22,23], skin [24], brain [25], stomach [23,26,27] and small intestine [26] among others. In most cases of HNPCC [13,16,18,20] and ovarian tumors [17,21,22], the majority of known mutations occur in Mlh1 and Msh2.…”