Binding Properties of RNA Quadruplex of SARS-CoV-2 to Berberine Compared to Telomeric DNA Quadruplex

Abstract

Previous studies suggest that berberine, an isoquinoline alkaloid, has antiviral potential and is a possible therapeutic candidate against SARS-CoV-2. The molecular underpinnings of its action are still unknown. Potential targets include quadruplexes (G4Q) in the viral genome as they play a key role in modulating the biological activity of viruses. While several DNA-G4Q structures and their binding properties have been elucidated, RNA-G4Qs such as RG-1 of the N-gene of SARS-CoV-2 are less explored. Using biophysical techniques, the berberine binding thermodynamics and the associated conformational and hydration changes of RG-1 could be characterized and compared with human telomeric DNA-G4Q 22AG. Berberine can interact with both quadruplexes. Substantial changes were observed in the interaction of berberine with 22AG and RG-1, which adopt different topologies that can also change upon ligand binding. The strength of interaction and the thermodynamic signatures were found to dependent not only on the initial conformation of the quadruplex, but also on the type of salt present in solution. Since berberine has shown promise as a G-quadruplex stabilizer that can modulate viral gene expression, this study may also contribute to the development of optimized ligands that can discriminate between binding to DNA and RNA G-quadruplexes.

Pressure Tuning Studies of Four-Stranded Nucleic Acid Structures

“…The binding of berberine to an RNA GQ of the SARS-CoV-2 virus was investigated in Winter’s laboratory [ 18 ]. Berberine has antiviral potential, and it is a possible therapeutic candidate against COVID-19.…”

“…G-quadruplexes are present in viral genomes in both DNA and RNA viruses, and they take part in the key steps of viral infection of the cell from replication to encapsidation [ 10 , 11 , 12 , 13 , 14 , 15 ]. This research was even further accelerated by the recent pandemic: the focus of the research turned to the genome of the SARS-CoV-2 virus [ 15 , 16 , 17 , 18 , 19 ].…”

Recent advances in applying G-quadruplex for SARS-CoV-2 targeting and diagnosis: A review

“…As a common folk medicine used for hundreds of years in China, berberine has shown antiviral, anti-allergic, and anti-inflammatory properties [43] . Quite recently, the binding properties of berberine to RG-1 were characterized [44] . Oliva et al designed a titration experiment that kept the concentration of RG-1 constant, while the concentration of berberine was varied.…”

“… Ligand targeting G4 G4 origin G4 sequence Effect Reference PDP RG-1 SARS-CoV-2 N protein coding sequence GGCUGGCAAUGGCGG It stabilizes the RG-1 and significantly reduces the expression levels of the SARS-CoV-2 N protein. [38] Berberine RG-1 SARS-CoV-2 N protein coding sequence GGCUGGCAAUGGCGG It interacts with RG-1 with binding constants of 2.8 ± 0.3 × 10 4 M −1 in NaCl, and 1.48 ± 0.3 × 10 4 M −1 in KCl [44] PDS PQS-675 Host TMPRSS2 coding sequence GGGCGGGCGGCCUGCAGGGACAUGGG It inhibits SARS-CoV-2 entry in cells and hinders SARS-CoV-2 infection in vivo . [46] …”

Unlocking G‐Quadruplexes as Targets and Tools against COVID‐19

“…[ 53 ] Berberine is a potential anti‐SARS‐CoV‐2 drug and Oliva et al . investigated the binding properties of RG‐1 to Berberine compared to telomeric G4, [ 54 ] contributing to the development of G4 ligands that can discriminate between binding to DNA and RNA G4s. For understanding the relationship between COVID‐19 and other diseases such as Parkinson's disease and type‐II diabetes mellitus, Mukherjee et al .…”